LXL04_030747 | RubberDandelionOmics

Gene overview

LXL04_030747

Reference: OH-1004 Chr: Chr06 Coordinates: 121942441-121945181 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1572 bp · LXL04_030747|LXL04_030747|OH1004|cDNA

atgcCATTGGAATCGTCGATGTCGGACCGCGAACCTGACGATACCGATACTGAGTTCGTTGAGATCGATCCCTCCGGTCGTTATGGTCGGTATAAAGAAGTGCTGGGAAAGGGGGCTTTCAAAAGAGTATACAAAGCATTTGATGAACTGGAAGGAATCGAAGTAGCTTGGAATCAAATTAGGGTTTCTGATTTCTTAAGACACCCCGATGAGCTAGAACGACTATACTCAGAAGTCCATTTgctcaaaactctcaaaca...

CDS

Download CDS FASTA

1572 bp · LXL04_030747|LXL04_030747|OH1004|CDS

ATGCCATTGGAATCGTCGATGTCGGACCGCGAACCTGACGATACCGATACTGAGTTCGTTGAGATCGATCCCTCCGGTCGTTATGGTCGGTATAAAGAAGTGCTGGGAAAGGGGGCTTTCAAAAGAGTATACAAAGCATTTGATGAACTGGAAGGAATCGAAGTAGCTTGGAATCAAATTAGGGTTTCTGATTTCTTAAGACACCCCGATGAGCTAGAACGACTATACTCAGAAGTCCATTTGCTCAAAACTCTCAAACA...

Protein

Download Protein FASTA

523 aa · LXL04_030747|LXL04_030747|OH1004|PROTEIN

MPLESSMSDREPDDTDTEFVEIDPSGRYGRYKEVLGKGAFKRVYKAFDELEGIEVAWNQIRVSDFLRHPDELERLYSEVHLLKTLKHKNIIKFYNSWVDTTHEHINFITEIFTSGTLRQYRKKHKHVDLRALKKWSKQILEGLSYLHSHDPPVIHRDLKCDNIFVNGNQGEVKIGDLGLAAILRQARSAHSVIGTPEFMAPELYEEEYNELVDIYAFGMCLLELVTFEYPYCECANAAQIYKKVTSGIKPAALLKVKDPE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030747`
TK1151 ID	TkA07G428380
OH-1004 ID	LXL04_030747
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030747

Location Chr06:121942441-121945181 (-)

Description Similar to WNK3: Probable serine/threonine-protein kinase WNK3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g48260`	May regulate flowering time by modulating the photoperiod pathway.	No verified direct reference in this release
`At5g28080`	May regulate flowering time by modulating the photoperiod pathway.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0108300`	Probable serine/threonine-protein kinase WNK2.	No verified direct reference in this release
`Os07g0572800`	Probable serine/threonine-protein kinase WNK1.	No verified direct reference in this release
`UniProt: A2YMV6`	Probable serine/threonine-protein kinase WNK1.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030747 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G48260

ath:AT5G28080

dosa:Os05g0108300

dosa:Os07g0572800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.539

Rank 1 · LXL04_030747 · OH-1004

Nucleus0.432

Rank 2 · LXL04_030747 · OH-1004

Cell membrane0.158

Rank 3 · LXL04_030747 · OH-1004

Endoplasmic reticulum0.053

Rank 4 · LXL04_030747 · OH-1004

Golgi apparatus0.049

Rank 5 · LXL04_030747 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase32-286 aa

PF07714.24PK_Tyr_Ser-Thr32-281 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030747	`PF00069.32`	Pkinase	32	286	1.3e-52	179.5
LXL04_030747	`PF07714.24`	PK_Tyr_Ser-Thr	32	281	6e-36	124.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9STK6`	Arabidopsis thaliana	Probable serine/threonine-protein kinase WNK3	63.477%	Swiss-Prot	strong database homology
`Q2V338`	Arabidopsis thaliana	Probable serine/threonine-protein kinase WNK9	57.442%	Swiss-Prot	strong database homology
`Q65X23`	Oryza sativa subsp. japonica	Probable serine/threonine-protein kinase WNK2	54.409%	Swiss-Prot	strong database homology
`Q0D598`	Oryza sativa subsp. japonica	Probable serine/threonine-protein kinase WNK1	54.757%	Swiss-Prot	strong database homology
`A2YMV6`	Oryza sativa subsp. indica	Probable serine/threonine-protein kinase WNK1	54.757%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card