LXL04_030729 | RubberDandelionOmics

Gene overview

LXL04_030729

Reference: OH-1004 Chr: Chr06 Coordinates: 121512499-121520655 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2832 bp · LXL04_030729|LXL04_030729|OH1004|cDNA

ATGTTCGTTCATTTCAAATCTCTCGTCTTTGAACTCTCGAAGCTAAATCACACCCATTCAAGAACCAAATCATTTCACGCTTTGCTAATCAAAACCTGTCTTCTCCACGATCCATTTTACGCAACTAAAATCATTAGATTTTACGCAATCAACAACGATGTTACCTCCGCCTGCAACCTGTTCGATGAAACTCCCAACAGAACCGTCTACCTCTGGAACTCCATCATCAGAGCTTACGCCCAAACTCATCGTTTCCATAA...

CDS

Download CDS FASTA

2832 bp · LXL04_030729|LXL04_030729|OH1004|CDS

ATGTTCGTTCATTTCAAATCTCTCGTCTTTGAACTCTCGAAGCTAAATCACACCCATTCAAGAACCAAATCATTTCACGCTTTGCTAATCAAAACCTGTCTTCTCCACGATCCATTTTACGCAACTAAAATCATTAGATTTTACGCAATCAACAACGATGTTACCTCCGCCTGCAACCTGTTCGATGAAACTCCCAACAGAACCGTCTACCTCTGGAACTCCATCATCAGAGCTTACGCCCAAACTCATCGTTTCCATAA...

Protein

Download Protein FASTA

943 aa · LXL04_030729|LXL04_030729|OH1004|PROTEIN

MFVHFKSLVFELSKLNHTHSRTKSFHALLIKTCLLHDPFYATKIIRFYAINNDVTSACNLFDETPNRTVYLWNSIIRAYAQTHRFHNAFRLFKQMLVSETKPDNFTFACILRACSESFDLEGLKFVHAKAIVSDLGSDSITASALVSAYSKFHLVDDASMVFDRLNKHDLVLLNTMITGYGSCGYWQKALNLFIIMRRFGNQPDGYTIVGLLSGLTCSSLLEIGQGIHGYCLRTGFDSNTHINSVLVSMYARCGCMNSAY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030729`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030729

Location Chr06:121512499-121520655 (-)

Description Similar to PCMP-E65: Putative pentatricopeptide repeat-containing protein At1g64310

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g64310`	Putative pentatricopeptide repeat-containing protein At1g64310.	No verified direct reference in this release
`At3g12770`	Pentatricopeptide repeat-containing protein At3g12770.	No verified direct reference in this release
`At4g21300`	Pentatricopeptide repeat-containing protein At4g21300.	No verified direct reference in this release
`At2g03380`	Pentatricopeptide repeat-containing protein At2g03380, mitochondrial.	No verified direct reference in this release
`At5g39350`	Pentatricopeptide repeat-containing protein At5g39350.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030729 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006979 response to oxidative stress Biological Process

GO:0009451 RNA modification Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0080156 mitochondrial mRNA modification Biological Process

GO:1900864 mitochondrial RNA modification Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G64310

ath:AT2G03380

ath:AT3G12770

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.520

Rank 1 · LXL04_030729 · OH-1004

Mitochondrion0.345

Rank 2 · LXL04_030729 · OH-1004

Nucleus0.056

Rank 3 · LXL04_030729 · OH-1004

Cytoplasm0.030

Rank 4 · LXL04_030729 · OH-1004

Endoplasmic reticulum0.018

Rank 5 · LXL04_030729 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13041.13PPR_268-115 aa

PF01535.27PPR71-96 aa

PF13041.13PPR_2169-215 aa

PF01535.27PPR173-200 aa

PF01535.27PPR344-369 aa

PF13041.13PPR_2371-419 aa

PF20431.5E_motif489-546 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030729	`PF13041.13`	PPR_2	68	115	7e-49	164.4
LXL04_030729	`PF01535.27`	PPR	71	96	2.6e-45	150.3
LXL04_030729	`PF13041.13`	PPR_2	169	215	7e-49	164.4
LXL04_030729	`PF01535.27`	PPR	173	200	2.6e-45	150.3
LXL04_030729	`PF01535.27`	PPR	344	369	2.6e-45	150.3
LXL04_030729	`PF13041.13`	PPR_2	371	419	7e-49	164.4
LXL04_030729	`PF20431.5`	E_motif	489	546	1.9e-06	28.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C7V5`	Arabidopsis thaliana	Putative pentatricopeptide repeat-containing protein At1g64310	47.985%	Swiss-Prot	moderate database homology
`Q9LTV8`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At3g12770	30.106%	Swiss-Prot	moderate database homology
`Q9STE1`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g21300	31.048%	Swiss-Prot	moderate database homology
`Q9ZQ74`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g03380, mitochondrial	31.439%	Swiss-Prot	moderate database homology
`Q9FLZ9`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At5g39350	31.499%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card