LXL04_030675 | RubberDandelionOmics

Gene overview

LXL04_030675

Reference: OH-1004 Chr: Chr06 Coordinates: 120602733-120605319 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

777 bp · LXL04_030675|LXL04_030675|OH1004|cDNA

ATGGATCCACCTATAATCAATGAGAGCTCCTTTTCAGTCGCCAATCCTTCGTCCTACACTTTAACCGGGATCTGGCCCTTTTCGTCGATCAATGGCGGTCGAAATGAGGGATTAGGGCTCAAAATGGGCACCCTGATTAATCGACTTGGGGAACCGAATAACAACCACGACGACGAATCCACAGTGACGGACCAtagcggtggtggtggtggcagGAAGCTGAGGGATGCAAATTTTGAAGATGAATCTTCAAAGATCAC...

CDS

Download CDS FASTA

777 bp · LXL04_030675|LXL04_030675|OH1004|CDS

ATGGATCCACCTATAATCAATGAGAGCTCCTTTTCAGTCGCCAATCCTTCGTCCTACACTTTAACCGGGATCTGGCCCTTTTCGTCGATCAATGGCGGTCGAAATGAGGGATTAGGGCTCAAAATGGGCACCCTGATTAATCGACTTGGGGAACCGAATAACAACCACGACGACGAATCCACAGTGACGGACCATAGCGGTGGTGGTGGTGGCAGGAAGCTGAGGGATGCAAATTTTGAAGATGAATCTTCAAAGATCAC...

Protein

Download Protein FASTA

258 aa · LXL04_030675|LXL04_030675|OH1004|PROTEIN

MDPPIINESSFSVANPSSYTLTGIWPFSSINGGRNEGLGLKMGTLINRLGEPNNNHDDESTVTDHSGGGGGRKLRDANFEDESSKITSTSSVNDLSNFHGKRMKMSGSKDELCGLKIEQKATEPPKDYIHVRARRGQATDSHSLAERARREKISERMKILQDLVPGCNKVIGKALVLDEIINYIQSLQHQVEFLSMKLEAVTTRMNHPVEGFPTKDLVPPSLDAAGLLFGSQSTRGFGPGSDPEWLHMQLGNRFGRAT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030675`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030675

Location Chr06:120602733-120605319 (+)

Description Similar to BHLH79: Transcription factor bHLH79

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g62610`	Transcription factor bHLH79.	No verified direct reference in this release
`At1g59640`	Involved in the control of petal size, by interfering with postmitotic cell expansion to limit final petal cell size.	No verified direct reference in this release
`At3g07340`	Transcription factor bHLH62.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0193800`	Transcription factor that forms a ternary complex with RSS3 and TIFY11A/JAZ9 to negatively regulate jasmonate-responsive genes.	No verified direct reference in this release
`Os03g0802900`	Transcription factor that may regulate jasmonate-regulated genes.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030675 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0048446 petal morphogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference

ath:AT1G59640

ath:AT3G07340

ath:AT5G62610

dosa:Os03g0802900

dosa:Os07g0193800

osa:4334471

osa:4342637

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.975

Rank 1 · LXL04_030675 · OH-1004

Cytoplasm0.091

Rank 2 · LXL04_030675 · OH-1004

Cell membrane0.026

Rank 3 · LXL04_030675 · OH-1004

Endoplasmic reticulum0.013

Rank 4 · LXL04_030675 · OH-1004

Plastid0.011

Rank 5 · LXL04_030675 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010.32HLH141-188 aa

PF23173.3bHLH_SAC51146-190 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030675	`PF00010.32`	HLH	141	188	2.7e-09	37.4
LXL04_030675	`PF23173.3`	bHLH_SAC51	146	190	1.9e-08	34.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LV17`	Arabidopsis thaliana	Transcription factor bHLH79	52.817%	Swiss-Prot	strong database homology
`Q0JXE7`	Arabidopsis thaliana	Transcription factor BPE	64.417%	Swiss-Prot	moderate database homology
`Q9SRT2`	Arabidopsis thaliana	Transcription factor bHLH62	57.051%	Swiss-Prot	moderate database homology
`Q69WS3`	Oryza sativa subsp. japonica	Transcription factor BHLH094	59.314%	Swiss-Prot	moderate database homology
`Q84T08`	Oryza sativa subsp. japonica	Transcription factor BHLH089	56.436%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card