LXL04_030645 | RubberDandelionOmics

Gene overview

LXL04_030645

Reference: OH-1004 Chr: Chr06 Coordinates: 120201968-120203366 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

600 bp · LXL04_030645|LXL04_030645|OH1004|cDNA

ATGGGAGCAGAAAGATCATCTACTTGCTTGCACACCACCAAGAAGAATCCAGGTAAAGTTCCCAAAAGAATTCACAAGGCTGAAAGGGAGAAAATGAAACGTGAACATTTAAATGAACTCTTCCTTGAATTAGCTGGTGCACTTGAACTCTCAGAGCAAAACAGTGGGAAGGCGTCTATATTGGGTGAAACTACTCGTGCTGTGAAGGACATGATTGATCAAATCAAATCCCTCAAAAAGGAAAATGCAACTTTACTCTC...

CDS

Download CDS FASTA

600 bp · LXL04_030645|LXL04_030645|OH1004|CDS

ATGGGAGCAGAAAGATCATCTACTTGCTTGCACACCACCAAGAAGAATCCAGGTAAAGTTCCCAAAAGAATTCACAAGGCTGAAAGGGAGAAAATGAAACGTGAACATTTAAATGAACTCTTCCTTGAATTAGCTGGTGCACTTGAACTCTCAGAGCAAAACAGTGGGAAGGCGTCTATATTGGGTGAAACTACTCGTGCTGTGAAGGACATGATTGATCAAATCAAATCCCTCAAAAAGGAAAATGCAACTTTACTCTC...

Protein

Download Protein FASTA

199 aa · LXL04_030645|LXL04_030645|OH1004|PROTEIN

MGAERSSTCLHTTKKNPGKVPKRIHKAEREKMKREHLNELFLELAGALELSEQNSGKASILGETTRAVKDMIDQIKSLKKENATLLSESQYVMVERNELEDETCGLQKQITELKNIIKERTVNVNVNVSAQTNLDLNAPAVESHEPQYINPVFVIPACHPPSVAIDNNTPMTNVSKPYPRYPTPSDSWPLQLLEKPSRV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030645`
TK1151 ID	TkA07G420990
OH-1004 ID	LXL04_030645
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030645

Location Chr06:120201968-120203366 (+)

Description Similar to BHLH47: Transcription factor bHLH47

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g47640`	Transcription factor bHLH47.	No verified direct reference in this release
`At4g36060`	Transcription factor bHLH11.	No verified direct reference in this release
`At3g19860`	Transcription factor bHLH121.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0379300`	Transcription factor that acts as a negative regulator of the iron deficiency response.	Identification of a novel iron regulated basic helix-loop-helix protein involved in Fe homeostasis in Oryza sativa.2010 · DOI: 10.1186/1471-2229-10-166
`Os07g0628500`	Transcription factor that plays a positive role in salt stress tolerance.	OsJAZ9 acts as a transcriptional regulator in jasmonate signaling and modulates salt stress tolerance in rice.2015 · DOI: 10.1016/j.plantsci.2014.12.010

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030645 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006879 intracellular iron ion homeostasis Biological Process

GO:0010039 response to iron ion Biological Process

GO:0010106 cellular response to iron ion starvation Biological Process

GO:0060586 multicellular organismal-level iron ion homeostasis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference

ath:AT3G19860

ath:AT3G47640

ath:AT4G36060

dosa:Os03g0379300

dosa:Os07g0628500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.957

Rank 1 · LXL04_030645 · OH-1004

Cytoplasm0.148

Rank 2 · LXL04_030645 · OH-1004

Cell membrane0.023

Rank 3 · LXL04_030645 · OH-1004

Endoplasmic reticulum0.013

Rank 4 · LXL04_030645 · OH-1004

Plastid0.008

Rank 5 · LXL04_030645 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23177.2bHLH_IRO325-107 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030645	`PF23177.2`	bHLH_IRO3	25	107	8.7e-18	65.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SN74`	Arabidopsis thaliana	Transcription factor bHLH47	44.240%	Swiss-Prot	moderate database homology
`Q8W2F2`	Arabidopsis thaliana	Transcription factor bHLH11	43.023%	Swiss-Prot	weak database homology
`Q9LT23`	Arabidopsis thaliana	Transcription factor bHLH121	35.870%	Swiss-Prot	weak database homology
`Q10KL8`	Oryza sativa subsp. japonica	Protein IRON-RELATED TRANSCRIPTION FACTOR 3	37.143%	Swiss-Prot	moderate database homology
`Q69V10`	Oryza sativa subsp. japonica	Transcription factor BHLH062	38.389%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card