LXL04_030611 | RubberDandelionOmics

Gene overview

LXL04_030611

Reference: OH-1004 Chr: Chr06 Coordinates: 119526131-119542726 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6546 bp · LXL04_030611|LXL04_030611|OH1004|cDNA

ATGGCTAATAGCACGGAAATCATGCTTACGAAAGTTAAGATCCCTCTTCCTGATATGGTGGCTGCAATTTTGGCTATGGATGAAAAGCTTATAGATTCCGATCAAGTAGAAAATTGTCTTAAATTATATCCCACGAAAGAAGAGATTGAGCAACTTAAGAATTTCACAGGTGATTATAATAAACTGCGCAAGCGTGAACAGTATGTCGTGGAGCTAATGAAGGTGCCACGTATGGACACTAAATTAAGGGTTTTTCTGTT...

CDS

Download CDS FASTA

6546 bp · LXL04_030611|LXL04_030611|OH1004|CDS

ATGGCTAATAGCACGGAAATCATGCTTACGAAAGTTAAGATCCCTCTTCCTGATATGGTGGCTGCAATTTTGGCTATGGATGAAAAGCTTATAGATTCCGATCAAGTAGAAAATTGTCTTAAATTATATCCCACGAAAGAAGAGATTGAGCAACTTAAGAATTTCACAGGTGATTATAATAAACTGCGCAAGCGTGAACAGTATGTCGTGGAGCTAATGAAGGTGCCACGTATGGACACTAAATTAAGGGTTTTTCTGTT...

Protein

Download Protein FASTA

2181 aa · LXL04_030611|LXL04_030611|OH1004|PROTEIN

MANSTEIMLTKVKIPLPDMVAAILAMDEKLIDSDQVENCLKLYPTKEEIEQLKNFTGDYNKLRKREQYVVELMKVPRMDTKLRVFLFKMQFNPQVSQYKKNLNTVNSTCDEVRRSVKLKEIMKRILYLGNTLNQGTDRGAAVGFKLDSLLKLTDTRASNSKMTLMHYLCKVLASKSPTLLDFHKDLVSLEAATEIQMKVLAEEMQTILAGMEKANQELAASANDGPISEGFHKILKEFVGQAEAEMISVTNFYSVVCRNA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030611`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030611

Location Chr06:119526131-119542726 (+)

Description Similar to FH20: Formin-like protein 20

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q9FLQ7`	Formin-like protein 20.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0596300`	Formin-like protein 5.	No verified direct reference in this release
`Os08g0280200`	Formin-like protein 6.	No verified direct reference in this release
`UniProt: Q7XWS7`	Formin-like protein 12.	No verified direct reference in this release
`Os10g0119300`	Formin-like protein 3.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030611 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005737 cytoplasm Cellular Component

GO:0004721 phosphoprotein phosphatase activity Molecular Function

KEGG gene cross-reference

ath:AT5G07740

dosa:Os07g0596300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.623

Rank 1 · LXL04_030611 · OH-1004

Cell membrane0.326

Rank 2 · LXL04_030611 · OH-1004

Nucleus0.178

Rank 3 · LXL04_030611 · OH-1004

Golgi apparatus0.058

Rank 4 · LXL04_030611 · OH-1004

Endoplasmic reticulum0.045

Rank 5 · LXL04_030611 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02181.29FH22-290 aa

PF02181.29FH2500-859 aa

PF10409.16PTEN_C21077-1211 aa

PF02181.29FH21775-2142 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030611	`PF02181.29`	FH2	2	290	3.3e-293	971.7
LXL04_030611	`PF02181.29`	FH2	500	859	3.3e-293	971.7
LXL04_030611	`PF10409.16`	PTEN_C2	1077	1211	2.7e-31	108.8
LXL04_030611	`PF02181.29`	FH2	1775	2142	3.3e-293	971.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLQ7`	Arabidopsis thaliana	Formin-like protein 20	70.362%	Swiss-Prot	weak database homology
`Q84ZL0`	Oryza sativa subsp. japonica	Formin-like protein 5	67.453%	Swiss-Prot	weak database homology
`Q6ZCX3`	Oryza sativa subsp. japonica	Formin-like protein 6	62.791%	Swiss-Prot	weak database homology
`Q7XWS7`	Oryza sativa subsp. japonica	Formin-like protein 12	64.250%	Swiss-Prot	weak database homology
`Q7G6K7`	Oryza sativa subsp. japonica	Formin-like protein 3	59.016%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card