LXL04_030484 | RubberDandelionOmics

Gene overview

LXL04_030484

Reference: OH-1004 Chr: Chr06 Coordinates: 116895414-116897744 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1293 bp · LXL04_030484|LXL04_030484|OH1004|cDNA

GGATCCGAAGATCAAAGCGCTATATAAACAAGTAGAAAGCTTCATCAAGAAGAGGCACTGAGGCAGGGAAGGATAACGGAGCAGCATCCATTCCCCACAAAAACCCAAAAAGCCCCAATTATGGGCGCCGAATTTCTCCCAAAATCAAGTGAGAATGATCTATCCGGCGATTATCAGGCTGCTCCGGTGATACTCGGCCTCCTGCCCGCTGCCCTAGTTGACCACATAGCAAGGGTTGATCTATCAATTCTCTCTCGAAT...

CDS

Download CDS FASTA

1236 bp · LXL04_030484|LXL04_030484|OH1004|CDS

CTGAGGCAGGGAAGGATAACGGAGCAGCATCCATTCCCCACAAAAACCCAAAAAGCCCCAATTATGGGCGCCGAATTTCTCCCAAAATCAAGTGAGAATGATCTATCCGGCGATTATCAGGCTGCTCCGGTGATACTCGGCCTCCTGCCCGCTGCCCTAGTTGACCACATAGCAAGGGTTGATCTATCAATTCTCTCTCGAATTCCCGGCGAACCTGGTGGCTCCTTCCCCGTTGCAGCTGAAGAGCTGAAAGATATACT...

Protein

Download Protein FASTA

411 aa · LXL04_030484|LXL04_030484|OH1004|PROTEIN

MRQGRITEQHPFPTKTQKAPIMGAEFLPKSSENDLSGDYQAAPVILGLLPAALVDHIARVDLSILSRIPGEPGGSFPVAAEELKDILKEVNTHISSSPNDLSPVKTIAGGSVTNTIRGLAAGFGISCGVIGAYGDDEQGALFLKNMSFYGVNISRLRAKDVHTGQCVCLVDPMGNRTMRPCISTAAKIQACELKREDFKGSKWLVVRYSIYNLEVINAAIQIAKQEGLLISLDLASFEMVRKFKKPLLELLESGNIDLCF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030484`
TK1151 ID	TkA07G406810
OH-1004 ID	LXL04_030484
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.900
Protein coverage (%)	TK1151 100.000 / OH-1004 94.891 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030484

Location Chr06:116895414-116897744 (+)

Description Similar to slr0537: Uncharacterized sugar kinase slr0537 (Synechocystis sp. (strain PCC 6803 / Kazusa)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g03300`	Adenosine kinase that mediates the phosphorylation of the purine nucleoside adenosine at the 5' position in an ATP-dependent manner: catalyzes phosphorylation of both unmodified and modified adenosines.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030484 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006144 purine nucleobase metabolic process Biological Process

GO:0006169 adenosine salvage Biological Process

GO:0044209 AMP salvage Biological Process

GO:0110052 toxic metabolite repair Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004001 adenosine kinase activity Molecular Function

GO:0005507 copper ion binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016301 kinase activity Molecular Function

KEGG gene cross-reference

afu:AF_0356

ath:AT5G03300

syn:slr0537

tko:TK2029

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.588

Rank 1 · LXL04_030484 · OH-1004

Nucleus0.259

Rank 2 · LXL04_030484 · OH-1004

Mitochondrion0.130

Rank 3 · LXL04_030484 · OH-1004

Peroxisome0.125

Rank 4 · LXL04_030484 · OH-1004

Cell membrane0.074

Rank 5 · LXL04_030484 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00294.30PfkB98-384 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030484	`PF00294.30`	PfkB	98	384	1.1e-32	114.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LZG0`	Arabidopsis thaliana	Adenosine kinase 2	26.384%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card