LXL04_030478 | RubberDandelionOmics

Gene overview

LXL04_030478

Reference: OH-1004 Chr: Chr06 Coordinates: 116819048-116819890 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

843 bp · LXL04_030478|LXL04_030478|OH1004|cDNA

ATGGCGTTGAGTGGCAGTGAGAAAGAGATAGGAATGCAGACTTCGTCTCCTTACAACAACAATCACTTAATTAGGGAATCATCTTCCGAAACCGTGGATCATGGGTTGGATCCAGATCGGTTTCCCGGCACCGGAGCTTCCGTCACGCCGATTTCAGTCGGATCTAAGCTGTTGAAGTCGCCGTTGCAGATGCCGAGGTACCGAGAATGTCTCAAGAACCATGCCGCCAACATGGGCGGAAACATCACCGACGGATGCGG...

CDS

Download CDS FASTA

843 bp · LXL04_030478|LXL04_030478|OH1004|CDS

ATGGCGTTGAGTGGCAGTGAGAAAGAGATAGGAATGCAGACTTCGTCTCCTTACAACAACAATCACTTAATTAGGGAATCATCTTCCGAAACCGTGGATCATGGGTTGGATCCAGATCGGTTTCCCGGCACCGGAGCTTCCGTCACGCCGATTTCAGTCGGATCTAAGCTGTTGAAGTCGCCGTTGCAGATGCCGAGGTACCGAGAATGTCTCAAGAACCATGCCGCCAACATGGGCGGAAACATCACCGACGGATGCGG...

Protein

Download Protein FASTA

280 aa · LXL04_030478|LXL04_030478|OH1004|PROTEIN

MALSGSEKEIGMQTSSPYNNNHLIRESSSETVDHGLDPDRFPGTGASVTPISVGSKLLKSPLQMPRYRECLKNHAANMGGNITDGCGEFMPSGDDGTLEALKCAACNCHRNFHRKEYPATSPAGPFLQLPPPLPSPSPSPSFHHHHHHRTPAAISLHHHHHPNWASSINAPPVKMAFAGSVGGAATESSSEELNFTTGAVAPPYGMAKKRFRTKFTQDQKEKMLEFAEKVGWRIPREDDPEVQRFCAEVGVKRQVLKVWM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030478`
TK1151 ID	TkA07G406280
OH-1004 ID	LXL04_030478
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.600
Protein coverage (%)	TK1151 97.211 / OH-1004 87.143 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030478

Location Chr06:116819048-116819890 (-)

Description Similar to ZHD4: Zinc-finger homeodomain protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g14440`	Putative transcription factor.	No verified direct reference in this release
`At1g75240`	Putative transcription factor.	Nuclear import and DNA binding of the ZHD5 transcription factor is modulated by a competitive peptide inhibitor in Arabidopsis.2011 · DOI: 10.1074/jbc.m110.167692 Auxin Response Factor2 (ARF2) and its regulated homeodomain gene HB33 mediate abscisic acid response in Arabidopsis.2011 · DOI: 10.1371/journal.pgen.1002172
`At2g18350`	Putative transcription factor.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0466400`	Putative transcription factor.	No verified direct reference in this release
`UniProt: A2Z259`	Putative transcription factor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030478 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048574 long-day photoperiodism, flowering Biological Process

GO:0050793 regulation of developmental process Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G14440

ath:AT1G75240

ath:AT2G18350

dosa:Os09g0466400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.977

Rank 1 · LXL04_030478 · OH-1004

Cytoplasm0.083

Rank 2 · LXL04_030478 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_030478 · OH-1004

Endoplasmic reticulum0.014

Rank 4 · LXL04_030478 · OH-1004

Plastid0.009

Rank 5 · LXL04_030478 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04770.18ZF-HD_dimer66-116 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030478	`PF04770.18`	ZF-HD_dimer	66	116	4.5e-30	104.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M9S0`	Arabidopsis thaliana	Zinc-finger homeodomain protein 4	47.737%	Swiss-Prot	moderate database homology
`Q9FRL5`	Arabidopsis thaliana	Zinc-finger homeodomain protein 5	43.612%	Swiss-Prot	moderate database homology
`Q9ZPW7`	Arabidopsis thaliana	Zinc-finger homeodomain protein 6	47.642%	Swiss-Prot	moderate database homology
`Q6YXH5`	Oryza sativa subsp. japonica	Zinc-finger homeodomain protein 1	46.914%	Swiss-Prot	moderate database homology
`A2Z259`	Oryza sativa subsp. indica	Zinc-finger homeodomain protein 1	46.914%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card