LXL04_030452 | RubberDandelionOmics

Gene overview

LXL04_030452

Reference: OH-1004 Chr: Chr06 Coordinates: 116312529-116313680 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1152 bp · LXL04_030452|LXL04_030452|OH1004|cDNA

ATGGACATGTTGGaaacaatttcttctcctttACATTCTAGTTTTTCTGTTTTCGATGCCATTCGCAAACATCTTCTCGATGACCAGGATGACGCTGGTATGATGCTACCTGTGACGAGTCCCAGTGATGATCAGTCCTGTTTTAGTAAAGAAAACGATCCGGAATCTTTGAAGAAGATAATGGAACAGGACTCCGGTGAAGGTGAACACCAAATAACAAAACCAAAAAatgtgaagaagaagaagaagaaaacgcCGGC...

CDS

Download CDS FASTA

1152 bp · LXL04_030452|LXL04_030452|OH1004|CDS

ATGGACATGTTGGAAACAATTTCTTCTCCTTTACATTCTAGTTTTTCTGTTTTCGATGCCATTCGCAAACATCTTCTCGATGACCAGGATGACGCTGGTATGATGCTACCTGTGACGAGTCCCAGTGATGATCAGTCCTGTTTTAGTAAAGAAAACGATCCGGAATCTTTGAAGAAGATAATGGAACAGGACTCCGGTGAAGGTGAACACCAAATAACAAAACCAAAAAATGTGAAGAAGAAGAAGAAGAAAACGCCGGC...

Protein

Download Protein FASTA

383 aa · LXL04_030452|LXL04_030452|OH1004|PROTEIN

MDMLETISSPLHSSFSVFDAIRKHLLDDQDDAGMMLPVTSPSDDQSCFSKENDPESLKKIMEQDSGEGEHQITKPKNVKKKKKKTPAADGVEDDRPVEWTRYRGVRRRPWGKFTAEIRNPERKKARLWLGTFDTPEEAAVAYDKAAFQFRGNRAKVNFPLLLCNDVWKPESSSSSSTANSGICKNKVVVDPPMAAVEPPVSKNMAAVEEAKNKVTKPCQSTVHSPTTTSTSGIDQDQMCDLESIWDFSTCTLPPFSPAVD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030452`
TK1151 ID	TkA07G404150
OH-1004 ID	LXL04_030452
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030452

Location Chr06:116312529-116313680 (+)

Description Similar to ERF13: Ethylene-responsive transcription factor 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g44840`	Acts as a transcriptional activator.	No verified direct reference in this release
`At1g03800`	Involved in the regulation of gene expression by stress factors and by components of stress signal transduction pathways.	No verified direct reference in this release
`At1g22190`	Probably acts as a transcriptional activator.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030452 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009620 response to fungus Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010116 positive regulation of abscisic acid biosynthetic process Biological Process

GO:0010187 negative regulation of seed germination Biological Process

GO:0045487 gibberellin catabolic process Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G03800

ath:AT1G22190

ath:AT2G44840

nsy:104249597

nta:107790518

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.968

Rank 1 · LXL04_030452 · OH-1004

Cytoplasm0.094

Rank 2 · LXL04_030452 · OH-1004

Cell membrane0.036

Rank 3 · LXL04_030452 · OH-1004

Endoplasmic reticulum0.032

Rank 4 · LXL04_030452 · OH-1004

Plastid0.016

Rank 5 · LXL04_030452 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00847.27AP2100-152 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030452	`PF00847.27`	AP2	100	152	9.9e-15	55.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L9K1`	Arabidopsis thaliana	Ethylene-responsive transcription factor 13	41.259%	Swiss-Prot	weak database homology
`Q9ZWA2`	Arabidopsis thaliana	Ethylene-responsive transcription factor 10	52.381%	Swiss-Prot	weak database homology
`Q9LM15`	Arabidopsis thaliana	Ethylene-responsive transcription factor RAP2-13	44.737%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card