LXL04_030438 | RubberDandelionOmics

Gene overview

LXL04_030438

Reference: OH-1004 Chr: Chr06 Coordinates: 116022114-116024169 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1338 bp · LXL04_030438|LXL04_030438|OH1004|cDNA

ATGGCGGGGGCATTAACAGACGATAATCAGAAGCTATCTGTGTTCTTGAAGTCGGGGATTTACCGATTACAAGGTTCAAACGCCGTATTCATGGACCCAGTTCGCGTCCTTAACCTCTCCTACAGTCATTTCAGGGTTTCCCCATCTTCTTACTACTCTCGTTTCTTCGAACCGAATCCCTCGGGTGAAGAGCAATCTAGGGTTTCGCAAAATCAAAGAAAACGGAAACGTAAAGAGAAAAAACCTCCTGCCCTAAACGA...

CDS

Download CDS FASTA

1338 bp · LXL04_030438|LXL04_030438|OH1004|CDS

ATGGCGGGGGCATTAACAGACGATAATCAGAAGCTATCTGTGTTCTTGAAGTCGGGGATTTACCGATTACAAGGTTCAAACGCCGTATTCATGGACCCAGTTCGCGTCCTTAACCTCTCCTACAGTCATTTCAGGGTTTCCCCATCTTCTTACTACTCTCGTTTCTTCGAACCGAATCCCTCGGGTGAAGAGCAATCTAGGGTTTCGCAAAATCAAAGAAAACGGAAACGTAAAGAGAAAAAACCTCCTGCCCTAAACGA...

Protein

Download Protein FASTA

445 aa · LXL04_030438|LXL04_030438|OH1004|PROTEIN

MAGALTDDNQKLSVFLKSGIYRLQGSNAVFMDPVRVLNLSYSHFRVSPSSYYSRFFEPNPSGEEQSRVSQNQRKRKRKEKKPPALNEKEQAAEERHQNARPILMKAHELLLGANDLLRNLGKLRSDGDFPSHDCEPSTSTSDEHSLVELGSVWQAPLFEVSLYPHQHHSPTQGTSYIFHGWFAEVISTYCFDADSLSVQNCEKRNSPAFGSLVANETNSDMEADFLNRKYIIPKQSSFYMSDLKQIHGLIPVKQEFGFNL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030438`
TK1151 ID	TkA07G403050
OH-1004 ID	LXL04_030438
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.000
Protein coverage (%)	TK1151 99.764 / OH-1004 99.775 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030438

Location Chr06:116022114-116024169 (+)

Description Similar to At1g19340: Methyltransferase-like protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g19340`	Probable methyltransferase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030438 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0006914 autophagy Biological Process

GO:0010286 heat acclimation Biological Process

GO:0030435 sporulation resulting in formation of a cellular spore Biological Process

GO:0032259 methylation Biological Process

GO:0043484 regulation of RNA splicing Biological Process

GO:0043489 RNA stabilization Biological Process

GO:0045814 negative regulation of gene expression, epigenetic Biological Process

GO:0090296 regulation of mitochondrial DNA replication Biological Process

GO:0120049 snRNA (adenine-N6)-methylation Biological Process

GO:1903108 regulation of mitochondrial transcription Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G19340

hsa:64863

mgr:MGG_01492

mmu:76781

spo:2541669

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.706

Rank 1 · LXL04_030438 · OH-1004

Cytoplasm0.340

Rank 2 · LXL04_030438 · OH-1004

Mitochondrion0.055

Rank 3 · LXL04_030438 · OH-1004

Cell membrane0.042

Rank 4 · LXL04_030438 · OH-1004

Endoplasmic reticulum0.039

Rank 5 · LXL04_030438 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05063.21MT-A70258-432 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030438	`PF05063.21`	MT-A70	258	432	6.8e-34	118.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LFA9`	Arabidopsis thaliana	Methyltransferase-like protein 2	50.345%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card