LXL04_029924 | RubberDandelionOmics

Gene overview

LXL04_029924

Reference: OH-1004 Chr: Chr06 Coordinates: 103442426-103444548 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

888 bp · LXL04_029924|LXL04_029924|OH1004|cDNA

ATGGATTCTCGTCCATTGGACATAACGGTGATCTCCGCCAGTGGCCTGGACAATTTCCTATTGGTCTTCAAGATGAAAGTGTACGTCGTTGTATCGTTGATAAACGGCAAATCCGTCATTGAAAAAAAGACCCATATGTCCAACGGCCGGAACCCTAGGTGGAACCACCGCATAAAATTCCCCGTCGAGGAGTCCGCCATCCAGACCAGCACCCTCCTATTCGTCCTCCGGCAACACCGCTTACTTGGTGACAAAGACAT...

CDS

Download CDS FASTA

888 bp · LXL04_029924|LXL04_029924|OH1004|CDS

ATGGATTCTCGTCCATTGGACATAACGGTGATCTCCGCCAGTGGCCTGGACAATTTCCTATTGGTCTTCAAGATGAAAGTGTACGTCGTTGTATCGTTGATAAACGGCAAATCCGTCATTGAAAAAAAGACCCATATGTCCAACGGCCGGAACCCTAGGTGGAACCACCGCATAAAATTCCCCGTCGAGGAGTCCGCCATCCAGACCAGCACCCTCCTATTCGTCCTCCGGCAACACCGCTTACTTGGTGACAAAGACAT...

Protein

Download Protein FASTA

295 aa · LXL04_029924|LXL04_029924|OH1004|PROTEIN

MDSRPLDITVISASGLDNFLLVFKMKVYVVVSLINGKSVIEKKTHMSNGRNPRWNHRIKFPVEESAIQTSTLLFVLRQHRLLGDKDIGEVSIPVRDLLETNSGFGTTEHEVDYQVQSTRGKCKGTFTFSHEFREKVLPARGDGSSHPPPPGATYMVNQQGMPAAYPQGPYSTTQPGYVNYPCPQYGGAWYPPPTQPGAPPYPYPPPQQIGYNQQLQQGPEKKEQRSPFPFNPSSATTITSLQEGAIDSALQQLSDSADDR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029924`
TK1151 ID	TkA07G360040
OH-1004 ID	LXL04_029924
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	93.800
Protein coverage (%)	TK1151 98.919 / OH-1004 66.102 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029924

Location Chr06:103442426-103444548 (-)

Description Similar to SRC2: Protein SRC2 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09070`	May act as an activator of the calcium-dependent activation of RBOHF that mediates reactive oxygen species (ROS) production and may play a role in cold responses.	A low temperature-inducible protein AtSRC2 enhances the ROS-producing activity of NADPH oxidase AtRbohF.2013 · DOI: 10.1016/j.bbamcr.2013.06.024

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029924 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006623 protein targeting to vacuole Biological Process

GO:0006952 defense response Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0000326 protein storage vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0032586 protein storage vacuole membrane Cellular Component

KEGG gene cross-reference

ath:AT1G09070

gmx:547451

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.433

Rank 1 · LXL04_029924 · OH-1004

Nucleus0.363

Rank 2 · LXL04_029924 · OH-1004

Cell membrane0.285

Rank 3 · LXL04_029924 · OH-1004

Endoplasmic reticulum0.099

Rank 4 · LXL04_029924 · OH-1004

Lysosome / Vacuole0.066

Rank 5 · LXL04_029924 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00168.37C26-99 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029924	`PF00168.37`	C2	6	99	1.6e-12	48.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04023`	Arabidopsis thaliana	Protein SRC2 homolog	33.735%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card