LXL04_029923 | RubberDandelionOmics

Gene overview

LXL04_029923

Reference: OH-1004 Chr: Chr06 Coordinates: 103419145-103421487 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1134 bp · LXL04_029923|LXL04_029923|OH1004|cDNA

ATGTCCGGTGATGTCATTCGATGCAAAGCTGCGGTGGCATGGGAAGCCGGGAAGCCACTGGTAATAGAAGAAGTGGAGGTGGCGCCGCCGCAGAAAATGGAAGTCCGTTTGAAGATCCTCTTCACCTCCTTGTGCCACACCGATGTCTACTTTTGGGAAGCTAAGGGACAAAACCCCTTATTTCCTCGCATATTAGGTCATGAAGCAGGAGGAATTGTAGAGAGCGTAGGTGAAGGTGTGACGGAACTGAAAGAAGGGGA...

CDS

Download CDS FASTA

1134 bp · LXL04_029923|LXL04_029923|OH1004|CDS

ATGTCCGGTGATGTCATTCGATGCAAAGCTGCGGTGGCATGGGAAGCCGGGAAGCCACTGGTAATAGAAGAAGTGGAGGTGGCGCCGCCGCAGAAAATGGAAGTCCGTTTGAAGATCCTCTTCACCTCCTTGTGCCACACCGATGTCTACTTTTGGGAAGCTAAGGGACAAAACCCCTTATTTCCTCGCATATTAGGTCATGAAGCAGGAGGAATTGTAGAGAGCGTAGGTGAAGGTGTGACGGAACTGAAAGAAGGGGA...

Protein

Download Protein FASTA

377 aa · LXL04_029923|LXL04_029923|OH1004|PROTEIN

MSGDVIRCKAAVAWEAGKPLVIEEVEVAPPQKMEVRLKILFTSLCHTDVYFWEAKGQNPLFPRILGHEAGGIVESVGEGVTELKEGDKVLPVFTGECGDCRHCKSEESNMCDLLRINTDRGTMINDGKTRFSKDGNPIYHFLGTSTFSEYTVVHSGCVAKINPDAPLDKVCVLSCGISTGMGATLNVAKPKKGMTVAVFGLGAVGLAAAEGARIAGASRIIGIDLNASRAEDAKKFGVTEFVNPKDHDKPIQEVIIEMTD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029923`
TK1151 ID	TkA07G360030
OH-1004 ID	LXL04_029923
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029923

Location Chr06:103419145-103421487 (+)

Description Similar to ADH1: Alcohol dehydrogenase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g77120`	Alcohol dehydrogenase catalyzing the reduction of toxic aldehydes to the corresponding alcohols.	Enhanced low oxygen survival in Arabidopsis through increased metabolic flux in the fermentative pathway.2003 · DOI: 10.1104/pp.103.022244 High frequency targeted mutagenesis in Arabidopsis thaliana using zinc finger nucleases.2010 · DOI: 10.1073/pnas.0914991107 Structural and biochemical characterization of Arabidopsis alcohol dehydrogenases reveals distinct functional properties but similar redox sensitivity.2024 · DOI: 10.1111/tpj.16651

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029923 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001666 response to hypoxia Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009409 response to cold Biological Process

GO:0009413 response to flooding Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009744 response to sucrose Biological Process

GO:0031000 response to caffeine Biological Process

GO:0032355 response to estradiol Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0046294 formaldehyde catabolic process Biological Process

KEGG gene cross-reference

ath:AT1G77120

sly:544074

sot:102577519

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.605

Rank 1 · LXL04_029923 · OH-1004

Nucleus0.222

Rank 2 · LXL04_029923 · OH-1004

Cell membrane0.187

Rank 3 · LXL04_029923 · OH-1004

Mitochondrion0.129

Rank 4 · LXL04_029923 · OH-1004

Endoplasmic reticulum0.068

Rank 5 · LXL04_029923 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08240.18ADH_N33-161 aa

PF00107.33ADH_zinc_N203-334 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029923	`PF08240.18`	ADH_N	33	161	4.7e-21	75.7
LXL04_029923	`PF00107.33`	ADH_zinc_N	203	334	8.6e-28	97.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P06525`	Arabidopsis thaliana	Alcohol dehydrogenase class-P	84.574%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card