LXL04_029884 | RubberDandelionOmics

Gene overview

LXL04_029884

Reference: OH-1004 Chr: Chr06 Coordinates: 102783852-102788759 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2341 bp · LXL04_029884|LXL04_029884|OH1004|cDNA

TGCTTCTTCGCTTCAAGACGGCGTCGCACGTCACCCCAAGGGCCCAACGACCCACCACTCCTAGTAATAAAACCCCATCTAAATCCTCTTCCCTGCATCTATAGTCCCAATTTTGTTAAAAACAGAAGTTTCTTCTACTACACTACACACGATGGGAGGAACATCAACGATCTCAGTTGGCTCCGATGGGGTGGCTATCATCACCATCATCAACCCACCTGTTAATTCACTTTCTCTCGATGGTGCAAAAGGCAAATTTT...

CDS

Download CDS FASTA

2229 bp · LXL04_029884|LXL04_029884|OH1004|CDS

TTGTTAAAAACAGAAGTTTCTTCTACTACACTACACACGATGGGAGGAACATCAACGATCTCAGTTGGCTCCGATGGGGTGGCTATCATCACCATCATCAACCCACCTGTTAATTCACTTTCTCTCGATGGTGCAAAAGGCAAATTTTCTGGTGGTTTTGACATTAGTGCTTTTGGTGGAATGCATGAAGGAAAGGCTATGTCAACAGGACCATCATCAAAACCTGGTTATGTGTCGATCGATATTCTGTCTGACACCCT...

Protein

Download Protein FASTA

742 aa · LXL04_029884|LXL04_029884|OH1004|PROTEIN

MLKTEVSSTTLHTMGGTSTISVGSDGVAIITIINPPVNSLSLDGAKGKFSGGFDISAFGGMHEGKAMSTGPSSKPGYVSIDILSDTLEAARKPSVAAIDGLALGGGLEIAMACHARIATSTAQLGLPELQLGVIPGFGGTQRLPRLVGLAKALEMMLTSKPVRGLEAHTLGLVDEIVPGDQLLQTARKYALDILERRKPWISTLYKTDKLEPLGEAREILNFARAQARRQAPNLHHPQVCINVIEEGIVSGPRAGLIKEY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029884`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029884

Location Chr06:102783852-102788759 (+)

Description Similar to Glyoxysomal fatty acid beta-oxidation multifunctional protein MFP-a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g06860`	Involved in peroxisomal fatty acid beta-oxidation during seed germination.	The Arabidopsis thaliana multifunctional protein gene (MFP2) of peroxisomal beta-oxidation is essential for seedling establishment.2006 · DOI: 10.1111/j.1365-313x.2005.02650.x The multifunctional protein in peroxisomal beta-oxidation: structure and substrate specificity of the Arabidopsis thaliana protein MFP2.2010 · DOI: 10.1074/jbc.m110.106005 Peroxisomal β-oxidation regulates histone acetylation and DNA methylation in Arabidopsis .2019 · DOI: 10.1073/pnas.1904143116
`At4g29010`	Involved in peroxisomal fatty acid beta-oxidation.	A defect in beta-oxidation causes abnormal inflorescence development in Arabidopsis.1999 · DOI: 10.1105/tpc.11.10.1911 Jasmonate biosynthesis in Arabidopsis thaliana requires peroxisomal beta-oxidation enzymes--additional proof by properties of pex6 and aim1.2007 · DOI: 10.1016/j.phytochem.2007.04.024 The multifunctional protein in peroxisomal beta-oxidation: structure and substrate specificity of the Arabidopsis thaliana protein MFP2.2010 · DOI: 10.1074/jbc.m110.106005

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0274100`	Multifunctional enzyme involved in fatty acid beta-oxidation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029884 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006635 fatty acid beta-oxidation Biological Process

GO:0009695 jasmonic acid biosynthetic process Biological Process

GO:0009845 seed germination Biological Process

GO:0009908 flower development Biological Process

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005874 microtubule Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT3G06860

ath:AT4G29010

bna:106389027

csv:101210295

dosa:Os02g0274100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.584

Rank 1 · LXL04_029884 · OH-1004

Mitochondrion0.212

Rank 2 · LXL04_029884 · OH-1004

Cytoplasm0.176

Rank 3 · LXL04_029884 · OH-1004

Plastid0.068

Rank 4 · LXL04_029884 · OH-1004

Nucleus0.053

Rank 5 · LXL04_029884 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16113.11ECH_235-184 aa

PF00378.26ECH_142-203 aa

PF02737.253HCDH_N303-481 aa

PF00725.283HCDH484-577 aa

PF00725.283HCDH647-725 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029884	`PF16113.11`	ECH_2	35	184	1.6e-18	68.0
LXL04_029884	`PF00378.26`	ECH_1	42	203	6.5e-31	108.3
LXL04_029884	`PF02737.25`	3HCDH_N	303	481	1.2e-61	208.5
LXL04_029884	`PF00725.28`	3HCDH	484	577	2.9e-27	95.7
LXL04_029884	`PF00725.28`	3HCDH	647	725	2.9e-27	95.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZPI5`	Arabidopsis thaliana	Peroxisomal fatty acid beta-oxidation multifunctional protein MFP2	70.040%	Swiss-Prot	strong database homology
`Q9ZPI6`	Arabidopsis thaliana	Peroxisomal fatty acid beta-oxidation multifunctional protein AIM1	54.472%	Swiss-Prot	strong database homology
`Q8W1L6`	Oryza sativa subsp. japonica	Peroxisomal fatty acid beta-oxidation multifunctional protein	53.805%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card