LXL04_029773 | RubberDandelionOmics

Gene overview

LXL04_029773

Reference: OH-1004 Chr: Chr06 Coordinates: 99998619-99999877 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

783 bp · LXL04_029773|LXL04_029773|OH1004|cDNA

ATGGCGGCGGCAGCTTCTCTTGCAAACCCCACCACGTTTTCCTCCTCCTTACGCCGTGCTCACCACCACCAAGTGTCTGCTTCTGTCTCCACCTTCAATGTCTCGAATTCCAGAAAACAACGCTCGTTGAAACCCCTCATTTCCCAATCTATCCCGGCTTCTACATCCCCGGTTCAACGCCATACATCCATCGTCGCCGCGGCAACATCTGACTCATCTTCATCCAGTTCTGCCACTTCATTTCACGGCATGTGCTATGT...

CDS

Download CDS FASTA

783 bp · LXL04_029773|LXL04_029773|OH1004|CDS

ATGGCGGCGGCAGCTTCTCTTGCAAACCCCACCACGTTTTCCTCCTCCTTACGCCGTGCTCACCACCACCAAGTGTCTGCTTCTGTCTCCACCTTCAATGTCTCGAATTCCAGAAAACAACGCTCGTTGAAACCCCTCATTTCCCAATCTATCCCGGCTTCTACATCCCCGGTTCAACGCCATACATCCATCGTCGCCGCGGCAACATCTGACTCATCTTCATCCAGTTCTGCCACTTCATTTCACGGCATGTGCTATGT...

Protein

Download Protein FASTA

260 aa · LXL04_029773|LXL04_029773|OH1004|PROTEIN

MAAAASLANPTTFSSSLRRAHHHQVSASVSTFNVSNSRKQRSLKPLISQSIPASTSPVQRHTSIVAAATSDSSSSSSATSFHGMCYVVGDNIDTDQIIPAEYLTLVPSKPDEYKKLGSYALIGLPASYETRFVQAGEYQSKYSIIIGGDNFGCGSSREHAPVALGAAGVAAVVAESYARIFFRNSVATGEVYPLESEARICEECKTGDVVTIELAQSLLINHTTGKEYKLKPIGDAGPKLEAWLCRQDSSRSYVIFIWIT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029773`
TK1151 ID	TkA07G346080
OH-1004 ID	LXL04_029773
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.200
Protein coverage (%)	TK1151 82.594 / OH-1004 93.077 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029773

Location Chr06:99998619-99999877 (+)

Description Similar to SSU1: 3-isopropylmalate dehydratase small subunit 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43090`	Catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate, via the formation of 2-isopropylmaleate.	Functional specification of Arabidopsis isopropylmalate isomerases in glucosinolate and leucine biosynthesis.2010 · DOI: 10.1093/pcp/pcq113 The small subunit 1 of the Arabidopsis isopropylmalate isomerase is required for normal growth and development and the early stages of glucosinolate formation.2014 · DOI: 10.1371/journal.pone.0091071 In Arabidopsis thaliana Substrate Recognition and Tissue- as Well as Plastid Type-Specific Expression Define the Roles of Distinct Small Subunits of Isopropylmalate Isomerase.2020 · DOI: 10.3389/fpls.2020.00808
`At3g58990`	Catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate, via the formation of 2-isopropylmaleate (Probable).	Functional specification of Arabidopsis isopropylmalate isomerases in glucosinolate and leucine biosynthesis.2010 · DOI: 10.1093/pcp/pcq113 In Arabidopsis thaliana Substrate Recognition and Tissue- as Well as Plastid Type-Specific Expression Define the Roles of Distinct Small Subunits of Isopropylmalate Isomerase.2020 · DOI: 10.3389/fpls.2020.00808
`At2g43100`	Catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate, via the formation of 2-isopropylmaleate (Probable).	Functional specification of Arabidopsis isopropylmalate isomerases in glucosinolate and leucine biosynthesis.2010 · DOI: 10.1093/pcp/pcq113 In Arabidopsis thaliana Substrate Recognition and Tissue- as Well as Plastid Type-Specific Expression Define the Roles of Distinct Small Subunits of Isopropylmalate Isomerase.2020 · DOI: 10.3389/fpls.2020.00808

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029773 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009098 L-leucine biosynthetic process Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0019761 glucosinolate biosynthetic process Biological Process

GO:0048229 gametophyte development Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0003861 3-isopropylmalate dehydratase activity Molecular Function

GO:0120528 2-(omega-methylthio)alkylmalate dehydratase activity Molecular Function

KEGG gene cross-reference

ath:AT2G43090

ath:AT2G43100

ath:AT3G58990

tma:TM0555

tmi:THEMA_01900

tmw:THMA_0568

tye:THEYE_A0115

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.986

Rank 1 · LXL04_029773 · OH-1004

Mitochondrion0.026

Rank 2 · LXL04_029773 · OH-1004

Cytoplasm0.020

Rank 3 · LXL04_029773 · OH-1004

Nucleus0.015

Rank 4 · LXL04_029773 · OH-1004

Peroxisome0.013

Rank 5 · LXL04_029773 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00694.26Aconitase_C135-194 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029773	`PF00694.26`	Aconitase_C	135	194	2.6e-18	67.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZW85`	Arabidopsis thaliana	3-isopropylmalate dehydratase small subunit 1	61.538%	Swiss-Prot	strong database homology
`Q9LYT7`	Arabidopsis thaliana	3-isopropylmalate dehydratase small subunit 3	59.756%	Swiss-Prot	strong database homology
`Q9ZW84`	Arabidopsis thaliana	3-isopropylmalate dehydratase small subunit 2	64.500%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card