LXL04_029546 | RubberDandelionOmics

Gene overview

LXL04_029546

Reference: OH-1004 Chr: Chr06 Coordinates: 93515079-93516536 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1458 bp · LXL04_029546|LXL04_029546|OH1004|cDNA

ATGACACCCCGTTTACCAAATCCACTGAAACGTACGAAACCCAATGTAATTTCAATGCTGGTTACGAAAGTGACGACCTTGTTGAATCACCGTTTACGTGTCAATCAAGTGAAACAACTCCATGCTCTAGTACTTATCAATGGTCTCAGTTATCTCGAGCCTCTGGTGATCACCCAAATCATTTGCACACCATTTGGGCATTCTGAAGGTACACTCCATTATCTTCGGTCTCTTCTCCGCCACACAAAGCACCCAAATGT...

CDS

Download CDS FASTA

1458 bp · LXL04_029546|LXL04_029546|OH1004|CDS

ATGACACCCCGTTTACCAAATCCACTGAAACGTACGAAACCCAATGTAATTTCAATGCTGGTTACGAAAGTGACGACCTTGTTGAATCACCGTTTACGTGTCAATCAAGTGAAACAACTCCATGCTCTAGTACTTATCAATGGTCTCAGTTATCTCGAGCCTCTGGTGATCACCCAAATCATTTGCACACCATTTGGGCATTCTGAAGGTACACTCCATTATCTTCGGTCTCTTCTCCGCCACACAAAGCACCCAAATGT...

Protein

Download Protein FASTA

485 aa · LXL04_029546|LXL04_029546|OH1004|PROTEIN

MTPRLPNPLKRTKPNVISMLVTKVTTLLNHRLRVNQVKQLHALVLINGLSYLEPLVITQIICTPFGHSEGTLHYLRSLLRHTKHPNVTARASAIQFFYQRGEFREALREYARIQRSGIFPTTSTVASALKACTRIGNWIAGIRIHGQVYGYGFCGDVHVGTALVGLYSKINDMETAKKVLDEMSDRNSASRLINGYLESGNVPMAERIFSEMGHKDIASWDSMVSWYTRTGDMEKAIAYFGPMPVKTSSSWTSMIDGYID...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029546`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029546

Location Chr06:93515079-93516536 (-)

Description Similar to PCMP-E6: Pentatricopeptide repeat-containing protein At4g22760

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g22760`	Pentatricopeptide repeat-containing protein At4g22760.	No verified direct reference in this release
`At2g45350`	Plays a major role in chloroplast RNA editing.	A pentatricopeptide repeat protein is a site recognition factor in chloroplast RNA editing.2006 · DOI: 10.1074/jbc.m608184200 Two interacting proteins are necessary for the editing of the NdhD-1 site in Arabidopsis plastids.2012 · DOI: 10.1105/tpc.112.099507
`At1g08070`	Involved in multiple sites RNA editing events in chloroplasts.	No verified direct reference in this release
`At5g37570`	Putative pentatricopeptide repeat-containing protein At5g37570.	No verified direct reference in this release
`At3g21470`	Pentatricopeptide repeat-containing protein At3g21470.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029546 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0009451 RNA modification Biological Process

GO:0016556 mRNA modification Biological Process

GO:1900865 chloroplast RNA modification Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G45350

ath:AT3G21470

ath:AT4G22760

ath:AT5G37570

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.632

Rank 1 · LXL04_029546 · OH-1004

Plastid0.190

Rank 2 · LXL04_029546 · OH-1004

Nucleus0.050

Rank 3 · LXL04_029546 · OH-1004

Cytoplasm0.039

Rank 4 · LXL04_029546 · OH-1004

Cell membrane0.007

Rank 5 · LXL04_029546 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29070.1MSC6_N265-404 aa

PF13041.13PPR_2312-357 aa

PF01535.27PPR313-336 aa

PF13041.13PPR_2414-459 aa

PF13812.13PPR_3414-459 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029546	`PF29070.1`	MSC6_N	265	404	3.6e-13	50.1
LXL04_029546	`PF13041.13`	PPR_2	312	357	2.3e-48	162.8
LXL04_029546	`PF01535.27`	PPR	313	336	1.2e-42	141.9
LXL04_029546	`PF13041.13`	PPR_2	414	459	2.3e-48	162.8
LXL04_029546	`PF13812.13`	PPR_3	414	459	2.9e-17	63.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0C8Q5`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g22760	39.912%	Swiss-Prot	moderate database homology
`O22137`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g45350, chloroplastic	30.933%	Swiss-Prot	moderate database homology
`Q9LN01`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g08070, chloroplastic	28.571%	Swiss-Prot	weak database homology
`Q9FHR3`	Arabidopsis thaliana	Putative pentatricopeptide repeat-containing protein At5g37570	29.111%	Swiss-Prot	weak database homology
`Q9LVF9`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At3g21470	30.108%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card