LXL04_029464 | RubberDandelionOmics

Gene overview

LXL04_029464

Reference: OH-1004 Chr: Chr06 Coordinates: 91362795-91365799 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1026 bp · LXL04_029464|LXL04_029464|OH1004|cDNA

ATGCATCTTCCCAAGGCTGTCATCATTTCCCATGTACAGCTATCAACACTTCCTCCCCAAGGAAAAAGGTACCCGCCGTTCAAGTCTCCGGCACCGCCATCAGTGACACGAAGGGTGCGTGAAATCTGGGGCtcatcaagtggcgccatccgtgggacctcGAGCAAAACAGCCAACATTTCATACGGTCCTAACTACGTTCCTCATGGTTATATTCTTTTATGTGAGAAGTTGCTTTTCCAGAATGGACATAGTTCAAA...

CDS

Download CDS FASTA

1026 bp · LXL04_029464|LXL04_029464|OH1004|CDS

ATGCATCTTCCCAAGGCTGTCATCATTTCCCATGTACAGCTATCAACACTTCCTCCCCAAGGAAAAAGGTACCCGCCGTTCAAGTCTCCGGCACCGCCATCAGTGACACGAAGGGTGCGTGAAATCTGGGGCTCATCAAGTGGCGCCATCCGTGGGACCTCGAGCAAAACAGCCAACATTTCATACGGTCCTAACTACGTTCCTCATGGTTATATTCTTTTATGTGAGAAGTTGCTTTTCCAGAATGGACATAGTTCAAA...

Protein

Download Protein FASTA

341 aa · LXL04_029464|LXL04_029464|OH1004|PROTEIN

MHLPKAVIISHVQLSTLPPQGKRYPPFKSPAPPSVTRRVREIWGSSSGAIRGTSSKTANISYGPNYVPHGYILLCEKLLFQNGHSSKVVLTNLKNARLILRVNKVTISSFTFTSCARSKGENIKNANIYKLLFTPSLVEVYNELAPNGDLDIVFISADEDLDSFNGYFSKMPWLAVPFSDSKTRESLDKSFKVNGIPHLVFLDENGKLLTDRGVEIISEYGSEAYPFTPERMKEIKDEEEEARKNQSLNRDRKTRITNFQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029464`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029464

Location Chr06:91362795-91365799 (-)

Description Similar to At1g60420: Probable nucleoredoxin 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g60420`	Probable thiol-disulfide oxidoreductase required for pollen tube growth and pollen function in the pistil.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0405900`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release
`Os03g0405500`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release
`Os01g0794400`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029464 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009860 pollen tube growth Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004791 thioredoxin-disulfide reductase (NADPH) activity Molecular Function

KEGG gene cross-reference

ath:AT1G60420

dosa:Os03g0405900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.314

Rank 1 · LXL04_029464 · OH-1004

Mitochondrion0.298

Rank 2 · LXL04_029464 · OH-1004

Nucleus0.228

Rank 3 · LXL04_029464 · OH-1004

Cell membrane0.083

Rank 4 · LXL04_029464 · OH-1004

Peroxisome0.082

Rank 5 · LXL04_029464 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13905.13Thioredoxin_8132-207 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029464	`PF13905.13`	Thioredoxin_8	132	207	2.4e-16	60.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80763`	Arabidopsis thaliana	Probable nucleoredoxin 1	51.592%	Swiss-Prot	weak database homology
`Q7Y0F2`	Oryza sativa subsp. japonica	Probable nucleoredoxin 1-2	47.205%	Swiss-Prot	weak database homology
`Q7Y0E8`	Oryza sativa subsp. japonica	Probable nucleoredoxin 1-1	46.584%	Swiss-Prot	weak database homology
`Q0JIL1`	Oryza sativa subsp. japonica	Probable nucleoredoxin 2	33.544%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card