LXL04_029400 | RubberDandelionOmics

Gene overview

LXL04_029400

Reference: OH-1004 Chr: Chr06 Coordinates: 89187356-89190819 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1341 bp · LXL04_029400|LXL04_029400|OH1004|cDNA

ATGTCGATCCTCCCTCCTTCTTCCCCTACTCTCTTCTTATCCACCAGAAATCCTAGGGTTTCTCTGCTACCTTCTACTTCTACTTCTTCATCCTGGCGTGTTCGTTCGGCTCTCCGGCGGTTTCCGTGCTTGGCGTTTTCCGCCGCCCATGGCACGGCGGAAACGGTTCAAGACAAGAAGTGTTCGTTATCATCCACTCCGCCAACGGTCTCTGGATCCGAACTCGGTTACTCTAGTACATTCATCGATGCTCGCTCCGA...

CDS

Download CDS FASTA

1341 bp · LXL04_029400|LXL04_029400|OH1004|CDS

ATGTCGATCCTCCCTCCTTCTTCCCCTACTCTCTTCTTATCCACCAGAAATCCTAGGGTTTCTCTGCTACCTTCTACTTCTACTTCTTCATCCTGGCGTGTTCGTTCGGCTCTCCGGCGGTTTCCGTGCTTGGCGTTTTCCGCCGCCCATGGCACGGCGGAAACGGTTCAAGACAAGAAGTGTTCGTTATCATCCACTCCGCCAACGGTCTCTGGATCCGAACTCGGTTACTCTAGTACATTCATCGATGCTCGCTCCGA...

Protein

Download Protein FASTA

446 aa · LXL04_029400|LXL04_029400|OH1004|PROTEIN

MSILPPSSPTLFLSTRNPRVSLLPSTSTSSSWRVRSALRRFPCLAFSAAHGTAETVQDKKCSLSSTPPTVSGSELGYSSTFIDARSEQDLLSGIQRELEAGTLPKTVAQMMEELYYNYKNAVFKSGDPRAEEIVLSNMRVAFDRMFLDVKEPFEFSPYHEAIREPFNYYLFGQSYIRPLINFRESYVGNVSLFTKMEQQLKQGKNVILISNHQTEADPAVIALLLETTNPHISENIIYVAGDRVITDPLCKPFSMGRNLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029400`
TK1151 ID	TkA07G310370
OH-1004 ID	LXL04_029400
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029400

Location Chr06:89187356-89190819 (-)

Description Similar to Glycerol-3-phosphate acyltransferase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32200`	Esterifies acyl-group from acyl-ACP to the sn-1 position of glycerol-3-phosphate (Probable).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029400 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006655 phosphatidylglycerol biosynthetic process Biological Process

GO:0016024 CDP-diacylglycerol biosynthetic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004366 glycerol-3-phosphate O-acyltransferase activity Molecular Function

KEGG gene cross-reference

ag:CAA41769

ath:AT1G32200

csv:101213494

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.929

Rank 1 · LXL04_029400 · OH-1004

Mitochondrion0.079

Rank 2 · LXL04_029400 · OH-1004

Cytoplasm0.049

Rank 3 · LXL04_029400 · OH-1004

Nucleus0.035

Rank 4 · LXL04_029400 · OH-1004

Peroxisome0.025

Rank 5 · LXL04_029400 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14829.12GPAT_N78-153 aa

PF01553.27Acyltransferase197-349 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029400	`PF14829.12`	GPAT_N	78	153	7.9e-34	116.2
LXL04_029400	`PF01553.27`	Acyltransferase	197	349	6e-15	55.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q43307`	Arabidopsis thaliana	Glycerol-3-phosphate acyltransferase, chloroplastic	66.834%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card