LXL04_029367 | RubberDandelionOmics

Gene overview

LXL04_029367

Reference: OH-1004 Chr: Chr06 Coordinates: 88386720-88391008 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2112 bp · LXL04_029367|LXL04_029367|OH1004|cDNA

ATGTCCTTGCGCACTCACCCTTCTGCCGTTTTCTTCAAAGACATGTGGAAGAATCGCAATCTCCTCCTGACATTGATTGTTGCTTGCCGTCTGGCTAAGGCATTGGGGGCTGACTTCTTCAATACATCGTCTGTTGTCGAGTCCTCCACGCAAACAAGGAGTGAGGTACCACGGGCTTCACTTAGCATCAATCGTGCTTCATCTGTTAACAAGAAGGATACTGATGTAGCTTCAGAAGAGTTATTGGAAGCTTTGTGGGA...

CDS

Download CDS FASTA

2112 bp · LXL04_029367|LXL04_029367|OH1004|CDS

ATGTCCTTGCGCACTCACCCTTCTGCCGTTTTCTTCAAAGACATGTGGAAGAATCGCAATCTCCTCCTGACATTGATTGTTGCTTGCCGTCTGGCTAAGGCATTGGGGGCTGACTTCTTCAATACATCGTCTGTTGTCGAGTCCTCCACGCAAACAAGGAGTGAGGTACCACGGGCTTCACTTAGCATCAATCGTGCTTCATCTGTTAACAAGAAGGATACTGATGTAGCTTCAGAAGAGTTATTGGAAGCTTTGTGGGA...

Protein

Download Protein FASTA

703 aa · LXL04_029367|LXL04_029367|OH1004|PROTEIN

MSLRTHPSAVFFKDMWKNRNLLLTLIVACRLAKALGADFFNTSSVVESSTQTRSEVPRASLSINRASSVNKKDTDVASEELLEALWDDGYGTQTAKDYAYIAMDLIKHDGGPPRWFCPIACGIPLKDSPILLYIPGIDGTGTGLVVHEKALGKVFHVQCLHIPVQDRTPLEGLIQIVEEAIKIENKLSPNKPIYILGESFGGALALAIAARNPTIDLILILANPATSFERSQAYPVYPLLKALPQEHYTMFSYLMPPLLG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029367`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029367

Location Chr06:88386720-88391008 (-)

Description Similar to At1g54570: Acyltransferase-like protein At1g54570, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g54570`	Acyltransferase involved in fatty acid phytyl ester synthesis in chloroplasts, a process required for the maintenance of the photosynthetic membrane integrity during abiotic stress and senescence.	Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.2012 · DOI: 10.1105/tpc.112.095588
`At3g26840`	Acyltransferase involved in fatty acid phytyl ester synthesis in chloroplasts, a process required for the maintenance of the photosynthetic membrane integrity during abiotic stress and senescence.	Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.2012 · DOI: 10.1105/tpc.112.095588

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029367 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0010150 leaf senescence Biological Process

GO:0010866 regulation of triglyceride biosynthetic process Biological Process

GO:0019432 triglyceride biosynthetic process Biological Process

GO:0033306 phytol metabolic process Biological Process

GO:0090693 plant organ senescence Biological Process

GO:1904963 regulation of phytol biosynthetic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0010287 plastoglobule Cellular Component

GO:0016020 membrane Cellular Component

GO:0004144 diacylglycerol O-acyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G54570

ath:AT3G26840

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.481

Rank 1 · LXL04_029367 · OH-1004

Mitochondrion0.156

Rank 2 · LXL04_029367 · OH-1004

Endoplasmic reticulum0.152

Rank 3 · LXL04_029367 · OH-1004

Cytoplasm0.084

Rank 4 · LXL04_029367 · OH-1004

Golgi apparatus0.083

Rank 5 · LXL04_029367 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12697.14Abhydrolase_6169-375 aa

PF00561.27Abhydrolase_1171-375 aa

PF12146.16Hydrolase_4182-375 aa

PF03982.19DAGAT499-577 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029367	`PF12697.14`	Abhydrolase_6	169	375	1.2e-06	30.0
LXL04_029367	`PF00561.27`	Abhydrolase_1	171	375	2e-08	34.9
LXL04_029367	`PF12146.16`	Hydrolase_4	182	375	4.8e-12	46.4
LXL04_029367	`PF03982.19`	DAGAT	499	577	1.9e-08	34.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZVN2`	Arabidopsis thaliana	Phytyl ester synthase 1, chloroplastic	47.626%	Swiss-Prot	moderate database homology
`Q9LW26`	Arabidopsis thaliana	Phytyl ester synthase 2, chloroplastic	43.930%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card