LXL04_029289 | RubberDandelionOmics

Gene overview

LXL04_029289

Reference: OH-1004 Chr: Chr06 Coordinates: 86238784-86243943 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2187 bp · LXL04_029289|LXL04_029289|OH1004|cDNA

ATGACACCCCATCCAACCATTCGTCTCATAACTTACTCAAACGAGCTTATAAATGGCGACCCAATCCACATCTCTTCAAACTCTCTCCCCAAAAAAGTATCCCACTTTGAACCCGCGGGCCATTCCTTTCACGACATTGCCCTCAAACTCCGAGGCTATTTTGAGGAAGAAAATGACACCTCAgacaccaccaccaccaacaACAACCTCCCAAAAGACAAAGAACACGACTACATGCAATCATCAGATTCCTACAGCAG...

CDS

Download CDS FASTA

2187 bp · LXL04_029289|LXL04_029289|OH1004|CDS

ATGACACCCCATCCAACCATTCGTCTCATAACTTACTCAAACGAGCTTATAAATGGCGACCCAATCCACATCTCTTCAAACTCTCTCCCCAAAAAAGTATCCCACTTTGAACCCGCGGGCCATTCCTTTCACGACATTGCCCTCAAACTCCGAGGCTATTTTGAGGAAGAAAATGACACCTCAGACACCACCACCACCAACAACAACCTCCCAAAAGACAAAGAACACGACTACATGCAATCATCAGATTCCTACAGCAG...

Protein

Download Protein FASTA

728 aa · LXL04_029289|LXL04_029289|OH1004|PROTEIN

MTPHPTIRLITYSNELINGDPIHISSNSLPKKVSHFEPAGHSFHDIALKLRGYFEEENDTSDTTTTNNNLPKDKEHDYMQSSDSYSSSKGKKKNADGAIQQDHYALLGLGHLRYLATEEQIRKSYRETALKHHPDKQAALLLSEETESGKQLKKDEIENRFKSIQEAYEVLMDPTRRRIYDSTDEFDDEIPTDCSPNDFFKVFGPAFMRNGRWSVVAPPPMLGDDTTPLKEVDSFYDFWYGFKSWREFPHEEEFDLEQAE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029289`
TK1151 ID	TkA07G297290
OH-1004 ID	LXL04_029289
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.100
Protein coverage (%)	TK1151 99.842 / OH-1004 86.401 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_029289`
Location	Chr06:86238784-86243943 (+)
Description	Similar to Dnajc2: DnaJ homolog subfamily C member 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029289` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006260 DNA replication Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006450 regulation of translational fidelity Biological Process GO:0006457 protein folding Biological Process GO:0030308 negative regulation of cell growth Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0051083 'de novo' cotranslational protein folding Biological Process GO:1900034 regulation of cellular response to heat Biological Process GO:2000279 negative regulation of DNA biosynthetic process Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component
KEGG gene cross-reference	bta:507897 dre:403080 hsa:27000 mcf:101865260 rno:116456 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.753

Rank 1 · LXL04_029289 · OH-1004

Cytoplasm0.225

Rank 2 · LXL04_029289 · OH-1004

Cell membrane0.051

Rank 3 · LXL04_029289 · OH-1004

Mitochondrion0.034

Rank 4 · LXL04_029289 · OH-1004

Endoplasmic reticulum0.033

Rank 5 · LXL04_029289 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00226.37DnaJ102-181 aa

PF21884.3ZUO1-like_ZHD198-301 aa

PF23082.2Myb_DNA-binding_2463-532 aa

PF00249.38Myb_DNA-binding463-504 aa

PF00249.38Myb_DNA-binding575-618 aa

PF23082.2Myb_DNA-binding_2576-640 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029289	`PF00226.37`	DnaJ	102	181	6.8e-17	62.0
LXL04_029289	`PF21884.3`	ZUO1-like_ZHD	198	301	9.6e-40	136.2
LXL04_029289	`PF23082.2`	Myb_DNA-binding_2	463	532	4.2e-30	104.4
LXL04_029289	`PF00249.38`	Myb_DNA-binding	463	504	1.1e-14	54.9
LXL04_029289	`PF00249.38`	Myb_DNA-binding	575	618	1.1e-14	54.9
LXL04_029289	`PF23082.2`	Myb_DNA-binding_2	576	640	4.2e-30	104.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card