LXL04_029265 | RubberDandelionOmics

Gene overview

LXL04_029265

Reference: OH-1004 Chr: Chr06 Coordinates: 85469464-85476107 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2940 bp · LXL04_029265|LXL04_029265|OH1004|cDNA

ATGGTTGTGACTCCGTTCAATTTCACATGTGAAGGTGAGTCGACTCCGGACCATTTGATTGTTACCGAGTTGTTTGATTTAGTGAGGGAATTTGAAGAAAGGGAAAGCGAAGCTTTACTTCATCCAACAGAAACCCTGAAATCGAACAATTCATACACTGCAAAGCTGGAGCAGTTGAAGACGATCGGTAGGGAGCTCGCAATGGGCTCCCAGGGTGGTTTCGGTCAGTCTAAGGAGTTCTTGGACCTCGTCAAATCAAT...

CDS

Download CDS FASTA

2940 bp · LXL04_029265|LXL04_029265|OH1004|CDS

ATGGTTGTGACTCCGTTCAATTTCACATGTGAAGGTGAGTCGACTCCGGACCATTTGATTGTTACCGAGTTGTTTGATTTAGTGAGGGAATTTGAAGAAAGGGAAAGCGAAGCTTTACTTCATCCAACAGAAACCCTGAAATCGAACAATTCATACACTGCAAAGCTGGAGCAGTTGAAGACGATCGGTAGGGAGCTCGCAATGGGCTCCCAGGGTGGTTTCGGTCAGTCTAAGGAGTTCTTGGACCTCGTCAAATCAAT...

Protein

Download Protein FASTA

979 aa · LXL04_029265|LXL04_029265|OH1004|PROTEIN

MVVTPFNFTCEGESTPDHLIVTELFDLVREFEERESEALLHPTETLKSNNSYTAKLEQLKTIGRELAMGSQGGFGQSKEFLDLVKSIGEARSKSEEDRIVLHEIEMLKRRINEPDIPKRKMKEYIIRLVYIEMLGHDASFGYIHAVKMTHDDSLLLKRTGYLAVTLFLNEDHDLIILIVNTIQKDLKSDNYLVVCAALNAVCKLINEETIPAVIQQVVELLGHPKEGVRKKAVMALHSFYHRSPSSVNHLISHFRKKLCD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029265`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029265

Location Chr06:85469464-85476107 (-)

Description Similar to At1g31730: AP-4 complex subunit epsilon

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g31730`	Subunit of novel type of clathrin- or non-clathrin-associated protein coat involved in targeting proteins from the trans-Golgi network (TGN) to the endosomal-lysosomal system.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029265 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006605 protein targeting Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006895 Golgi to endosome transport Biological Process

GO:0006896 Golgi to vacuole transport Biological Process

GO:0008104 intracellular protein localization Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005905 clathrin-coated pit Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT1G31730

ddi:DDB_G0280427

ddi:DDB_G0281957

hsa:23431

mmu:108011

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.545

Rank 1 · LXL04_029265 · OH-1004

Golgi apparatus0.380

Rank 2 · LXL04_029265 · OH-1004

Cell membrane0.156

Rank 3 · LXL04_029265 · OH-1004

Nucleus0.143

Rank 4 · LXL04_029265 · OH-1004

Lysosome / Vacuole0.141

Rank 5 · LXL04_029265 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01602.27Adaptin_N107-650 aa

PF13646.13HEAT_2186-256 aa

PF12717.14Cnd1195-340 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029265	`PF01602.27`	Adaptin_N	107	650	6.8e-86	289.6
LXL04_029265	`PF13646.13`	HEAT_2	186	256	9.9e-08	32.9
LXL04_029265	`PF12717.14`	Cnd1	195	340	7.3e-07	30.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L7A9`	Arabidopsis thaliana	AP-4 complex subunit epsilon	67.398%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card