LXL04_029076 | RubberDandelionOmics

Gene overview

LXL04_029076

Reference: OH-1004 Chr: Chr06 Coordinates: 80120704-80130596 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5838 bp · LXL04_029076|LXL04_029076|OH1004|cDNA

ATGGAGGCGGCTGCAAACGATTTTCAAACGGAAGGAGCTGCGGCGCCACCCCCACCGCCACCACCATCTGAACCGATTCCTCCGGTGGAAGAAGATGACGAAGATGAGGAATatgaagaggaagaagaggaggaggaTGATGACGAGGAGGAAACAAATAACGAAGACGAAATTCTGATAGCGAAAGCGCAGGGACTGATAGACAAGATCACCGCCTCTCCTGATAACCCTAAGCCCAGCTGTCTTCATGCCCTAGCCTC...

CDS

Download CDS FASTA

5838 bp · LXL04_029076|LXL04_029076|OH1004|CDS

ATGGAGGCGGCTGCAAACGATTTTCAAACGGAAGGAGCTGCGGCGCCACCCCCACCGCCACCACCATCTGAACCGATTCCTCCGGTGGAAGAAGATGACGAAGATGAGGAATATGAAGAGGAAGAAGAGGAGGAGGATGATGACGAGGAGGAAACAAATAACGAAGACGAAATTCTGATAGCGAAAGCGCAGGGACTGATAGACAAGATCACCGCCTCTCCTGATAACCCTAAGCCCAGCTGTCTTCATGCCCTAGCCTC...

Protein

Download Protein FASTA

1945 aa · LXL04_029076|LXL04_029076|OH1004|PROTEIN

MEAAANDFQTEGAAAPPPPPPPSEPIPPVEEDDEDEEYEEEEEEEDDDEEETNNEDEILIAKAQGLIDKITASPDNPKPSCLHALASILETQEARYMEETGHSSLNNGRVSYNIGRLGNLLRDNDEFFELISVKFLSENRYTISVQAAALRLLFSCSLTWMYPHVFEETVLEHIKGWVMDGPTRSSTEDHKGKNGSAVKQASDSEMLKTYSTGLLAVCLAGGGQVVEDVLTSGLSAKLMRYLRIRVLGEASTSQKESNFL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029076`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029076

Location Chr06:80120704-80130596 (+)

Description Similar to DCAF1: DDB1- and CUL4-associated factor homolog 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g31160`	Component of the CUL4-RBX1-DDB1-DCAF1 E3 ubiquitin-protein ligase complex, DCAF1 may function as the substrate recognition module within this complex.	Arabidopsis DDB1-CUL4 ASSOCIATED FACTOR1 forms a nuclear E3 ubiquitin ligase with DDB1 and CUL4 that is involved in multiple plant developmental processes.2008 · DOI: 10.1105/tpc.108.058891

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029076 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009908 flower development Biological Process

GO:0010154 fruit development Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0035212 cell competition in a multicellular organism Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0043687 post-translational protein modification Biological Process

GO:0045732 positive regulation of protein catabolic process Biological Process

GO:0048366 leaf development Biological Process

GO:0048367 shoot system development Biological Process

KEGG gene cross-reference

ath:AT4G31160

hsa:9730

mmu:321006

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.554

Rank 1 · LXL04_029076 · OH-1004

Cytoplasm0.393

Rank 2 · LXL04_029076 · OH-1004

Cell membrane0.050

Rank 3 · LXL04_029076 · OH-1004

Mitochondrion0.046

Rank 4 · LXL04_029076 · OH-1004

Golgi apparatus0.039

Rank 5 · LXL04_029076 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27635.1Mahjong_helical493-640 aa

PF27600.1DCAF1_helical735-917 aa

PF27601.1DCAF1_4th996-1101 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029076	`PF27635.1`	Mahjong_helical	493	640	6.8e-18	66.2
LXL04_029076	`PF27600.1`	DCAF1_helical	735	917	1.6e-50	172.2
LXL04_029076	`PF27601.1`	DCAF1_4th	996	1101	1.9e-26	92.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M086`	Arabidopsis thaliana	DDB1- and CUL4-associated factor homolog 1	56.497%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card