LXL04_028893 | RubberDandelionOmics

Gene overview

LXL04_028893

Reference: OH-1004 Chr: Chr06 Coordinates: 73679352-73681793 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1884 bp · LXL04_028893|LXL04_028893|OH1004|cDNA

ATGGGGTGTGTGTTTGGGAGAGAGATTTCGTCTTCTGGACAACCAAGTTCTGAAATCGTAGTAGAAAAGAAGCGCGAGAGAGATAGACATACGGATTCCAATGTTCATTCCACGAGGAGAGAGAGAGCATCTACAGAAAACGCCGACACCACCATCAATGGCGGTGAGACACAAAATGGGGCTTctcaaaaagaagaaaaagacgGGAATGTGAGGCCGAGAGGTGAGAGAAGACGCTCAAAGCCTAACCCTAGACTCAG...

CDS

Download CDS FASTA

1710 bp · LXL04_028893|LXL04_028893|OH1004|CDS

ATGGGGTGTGTGTTTGGGAGAGAGATTTCGTCTTCTGGACAACCAAGTTCTGAAATCGTAGTAGAAAAGAAGCGCGAGAGAGATAGACATACGGATTCCAATGTTCATTCCACGAGGAGAGAGAGAGCATCTACAGAAAACGCCGACACCACCATCAATGGCGGTGAGACACAAAATGGGGCTTCTCAAAAAGAAGAAAAAGACGGGAATGTGAGGCCGAGAGGTGAGAGAAGACGCTCAAAGCCTAACCCTAGACTCAG...

Protein

Download Protein FASTA

569 aa · LXL04_028893|LXL04_028893|OH1004|PROTEIN

MGCVFGREISSSGQPSSEIVVEKKRERDRHTDSNVHSTRRERASTENADTTINGGETQNGASQKEEKDGNVRPRGERRRSKPNPRLSNPPKNIHGEQVAAGWPAWLSAVAGEAINGWIPRRADTFEKIDKASTYSNVYKAKDTMTGKIVALKKVRFDNLEPESVKFMAREILILRRLDHPNVVKLEGLVTSRMSCSLYLVFEYMEHDLAGLAASPTIKFTEPQVKCYMHQLLSGLEHCHNRNVLHRDIKGSNLLLDNGGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028893`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028893

Location Chr06:73679352-73681793 (+)

Description Similar to At1g54610: Probable serine/threonine-protein kinase At1g54610

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g54610`	Probable serine/threonine-protein kinase At1g54610.	No verified direct reference in this release
`At1g09600`	Probable serine/threonine-protein kinase At1g09600.	No verified direct reference in this release
`At1g18670`	Required for beta-aminobutyric acid (BABA)-induced resistance (BABA-IR) against bacteria (e.g. P.syringae) and oomycetes (e.g. H.parasitica) via priming for salicylate (SA)-dependent defense responses such as pathogenesis-related PR-1 gene expression and trailing necrosis.	Dissecting the beta-aminobutyric acid-induced priming phenomenon in Arabidopsis.2005 · DOI: 10.1105/tpc.104.029728 Descendants of primed Arabidopsis plants exhibit resistance to biotic stress.2012 · DOI: 10.1104/pp.111.191593
`At5g39420`	Cyclin-dependent kinase C-2 C.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0958000`	Cyclin-dependent kinase C-2.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028893 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002229 defense response to oomycetes Biological Process

GO:0009615 response to virus Biological Process

GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:1900426 positive regulation of defense response to bacterium Biological Process

GO:1902290 positive regulation of defense response to oomycetes Biological Process

GO:2000031 regulation of salicylic acid mediated signaling pathway Biological Process

GO:0000307 cyclin-dependent protein kinase holoenzyme complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004693 cyclin-dependent protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G09600

ath:AT1G18670

ath:AT1G54610

ath:AT5G39420

dosa:Os01g0958000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.635

Rank 1 · LXL04_028893 · OH-1004

Nucleus0.271

Rank 2 · LXL04_028893 · OH-1004

Cell membrane0.267

Rank 3 · LXL04_028893 · OH-1004

Golgi apparatus0.046

Rank 4 · LXL04_028893 · OH-1004

Endoplasmic reticulum0.032

Rank 5 · LXL04_028893 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase133-407 aa

PF07714.24PK_Tyr_Ser-Thr134-336 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028893	`PF00069.32`	Pkinase	133	407	8.6e-62	209.6
LXL04_028893	`PF07714.24`	PK_Tyr_Ser-Thr	134	336	1.1e-27	97.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZVM9`	Arabidopsis thaliana	Probable serine/threonine-protein kinase At1g54610	67.071%	Swiss-Prot	strong database homology
`F4I114`	Arabidopsis thaliana	Probable serine/threonine-protein kinase At1g09600	66.667%	Swiss-Prot	strong database homology
`F4ICB6`	Arabidopsis thaliana	Protein IMPAIRED IN BABA-INDUCED STERILITY 1	57.174%	Swiss-Prot	strong database homology
`B5X564`	Arabidopsis thaliana	Cyclin-dependent kinase C-2 C	58.354%	Swiss-Prot	strong database homology
`Q5JK68`	Oryza sativa subsp. japonica	Cyclin-dependent kinase C-2	50.862%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card