LXL04_028713 | RubberDandelionOmics

Gene overview

LXL04_028713

Reference: OH-1004 Chr: Chr06 Coordinates: 56776164-56778926 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

882 bp · LXL04_028713|LXL04_028713|OH1004|cDNA

ATGGCAAGTTTGTTTAAAGATGAGCAAGCTTGTGAATCATCTAAACATGCGTCCACGAGCAACCAATCAAATTTTGACCAAGAAACGGGTTCTTCAAATACACTAGAAAGAAGCCAAAACGAAGTCATAGTTAAAAGTCCCTCCTTCATATGCTGTCCACTCCAAATGGATAAAACCCTTGTCAGAATGGTTGTAGCAGAAGCCTTGGGGAGTTTTATTGTTATGTTCAGCATAGGTGGAATAATAAAAAGCACCGAACT...

CDS

Download CDS FASTA

882 bp · LXL04_028713|LXL04_028713|OH1004|CDS

ATGGCAAGTTTGTTTAAAGATGAGCAAGCTTGTGAATCATCTAAACATGCGTCCACGAGCAACCAATCAAATTTTGACCAAGAAACGGGTTCTTCAAATACACTAGAAAGAAGCCAAAACGAAGTCATAGTTAAAAGTCCCTCCTTCATATGCTGTCCACTCCAAATGGATAAAACCCTTGTCAGAATGGTTGTAGCAGAAGCCTTGGGGAGTTTTATTGTTATGTTCAGCATAGGTGGAATAATAAAAAGCACCGAACT...

Protein

Download Protein FASTA

293 aa · LXL04_028713|LXL04_028713|OH1004|PROTEIN

MASLFKDEQACESSKHASTSNQSNFDQETGSSNTLERSQNEVIVKSPSFICCPLQMDKTLVRMVVAEALGSFIVMFSIGGIIKSTELMRGVGLLEYAVTAALAVVVVVFSIGHISGAHVNPAVTIAFATVGPFPWRRVPLYIVAQVAGCAMATYAGVLVYDMKPEVMTTRPLLGHNAAFWAEFLASFFVLFLTASLVHAPPSVTQFSGFIVAVGIALGVLITAPISGGSMNPARSLGPALVSFNFHGLWIYLTAPTLGAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028713`
TK1151 ID	TkA07G193430
OH-1004 ID	LXL04_028713
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.700
Protein coverage (%)	TK1151 99.371 / OH-1004 53.925 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028713

Location Chr06:56776164-56778926 (-)

Description Similar to NIP7-1: Probable aquaporin NIP7-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g06100`	Aquaporins facilitate the transport of water and small neutral solutes across cell membranes.	No verified direct reference in this release
`At5g37810`	Potential aquaporin, which may facilitate the transport of water and small neutral solutes across cell membranes.	No verified direct reference in this release
`At5g37820`	Aquaporins facilitate the transport of water and small neutral solutes across cell membranes.	No verified direct reference in this release
`At4g19030`	Water channel probably required to promote glycerol permeability and water transport across cell membranes.	Functional identification of the glycerol permease activity of Arabidopsis thaliana NLM1 and NLM2 proteins by heterologous expression in Saccharomyces cerevisiae.2000 · DOI: 10.1016/s0014-5793(00)02027-5

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028713 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015700 arsenite transport Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0035445 borate transmembrane transport Biological Process

GO:0046685 response to arsenic-containing substance Biological Process

GO:0080170 hydrogen peroxide transmembrane transport Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0015105 arsenite transmembrane transporter activity Molecular Function

GO:0015250 water channel activity Molecular Function

KEGG gene cross-reference

ath:AT3G06100

ath:AT4G19030

ath:AT5G37810

ath:AT5G37820

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.613

Rank 1 · LXL04_028713 · OH-1004

Cytoplasm0.161

Rank 2 · LXL04_028713 · OH-1004

Endoplasmic reticulum0.152

Rank 3 · LXL04_028713 · OH-1004

Lysosome / Vacuole0.119

Rank 4 · LXL04_028713 · OH-1004

Golgi apparatus0.073

Rank 5 · LXL04_028713 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00230.26MIP59-265 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028713	`PF00230.26`	MIP	59	265	5.6e-41	141.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LAI1`	Arabidopsis thaliana	Probable aquaporin NIP7-1	51.575%	Swiss-Prot	strong database homology
`Q9FIZ9`	Arabidopsis thaliana	Putative aquaporin NIP4-1	34.520%	Swiss-Prot	moderate database homology
`Q8W036`	Arabidopsis thaliana	Probable aquaporin NIP4-2	33.835%	Swiss-Prot	moderate database homology
`Q8VZW1`	Arabidopsis thaliana	Aquaporin NIP1-1	32.130%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card