Gene Card
Gene overview
cDNA / CDS / Protein Sequences
753 bp · LXL04_028636|LXL04_028636|OH1004|cDNA
ATGTTGGCAGTATTCGACAAGGCAGTAGCCAAGAGCCCAGAGGGACTACAGACCCCACAACAAGAACCGCCGGTGAACGCACTCAAAGATGGCCTTTTGTCCCGCCACTTCTCCGCCGTGCATCCGTCCGCCGTCGCCATAAACCTCGCCGGTTCTGGTCTTATCTCTTACTCCATCGATAAACAAAACCCCCTTCTTCCCAGATTGTTTGCGGTTGTGGACGACATATTCTGCTTGTTTCAAGGTCACGTAGAGAACGT...
753 bp · LXL04_028636|LXL04_028636|OH1004|CDS
ATGTTGGCAGTATTCGACAAGGCAGTAGCCAAGAGCCCAGAGGGACTACAGACCCCACAACAAGAACCGCCGGTGAACGCACTCAAAGATGGCCTTTTGTCCCGCCACTTCTCCGCCGTGCATCCGTCCGCCGTCGCCATAAACCTCGCCGGTTCTGGTCTTATCTCTTACTCCATCGATAAACAAAACCCCCTTCTTCCCAGATTGTTTGCGGTTGTGGACGACATATTCTGCTTGTTTCAAGGTCACGTAGAGAACGT...
Protein
Download Protein FASTA250 aa · LXL04_028636|LXL04_028636|OH1004|PROTEIN
MLAVFDKAVAKSPEGLQTPQQEPPVNALKDGLLSRHFSAVHPSAVAINLAGSGLISYSIDKQNPLLPRLFAVVDDIFCLFQGHVENVAPLKQQYGLNKTANEVTIVIEAYRTLRDRGPYPADQVVRDLQGKFAFVLYDSTSNSTFIAADADGSVPFFWGTDSEGNVVLSDDVETVKKGCGKSFAPFPKGCFFTTSGGLRSFEHPFNELKAVPRVDSSGEMCGANFKVDAGSRKEAGMPRVGSAANWSQHY
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_028636 |
|---|---|
| TK1151 ID | TkA07G176580 |
| OH-1004 ID | LXL04_028636 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 96.300 |
| Protein coverage (%) | TK1151 96.410 / OH-1004 75.600Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_028636 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:50522787-50523923 (+) | |||||||||
| Description | Similar to TSJT1: Stem-specific protein TSJT1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. Rice
| |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006541 glutamine metabolic process Biological Process GO:0006950 response to stress Biological Process GO:0008652 amino acid biosynthetic process Biological Process GO:0009063 amino acid catabolic process Biological Process GO:0070981 L-asparagine biosynthetic process Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0045335 phagocytic vesicle Cellular Component GO:0004066 asparagine synthase (glutamine-hydrolyzing) activity Molecular Function GO:0004071 aspartate-ammonia ligase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0016597 amino acid binding Molecular Function | |||||||||
| KEGG gene cross-reference | ddi:DDB_G0286059 dosa:Os03g0291500 dosa:Os06g0265000 ecj:JW0660 eco:b0674 ecoc:C3026_03350 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF12481.14DUF37002-227 aaPF13537.12GATase_775-169 aaPF13522.13GATase_679-179 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_028636 | PF12481.14 | DUF3700 | 2 | 227 | 5.8e-112 | 373.4 |
| LXL04_028636 | PF13537.12 | GATase_7 | 75 | 169 | 1.5e-08 | 35.4 |
| LXL04_028636 | PF13522.13 | GATase_6 | 79 | 179 | 1.5e-08 | 35.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.