LXL04_028324 | RubberDandelionOmics

Gene overview

LXL04_028324

Reference: OH-1004 Chr: Chr06 Coordinates: 37801720-37803020 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

813 bp · LXL04_028324|LXL04_028324|OH1004|cDNA

ATGGAGAAAAACAATACCACCGATACAAGAAACATGGGGTTCCAATTTGCCGGGAAAGCTGTATACACAGCAGTATGGGTGGCTGCTGTATCACTTTTCATGGAGTTACTTGGTTTTTCTACCCAAAAATGGCTAACTGCAGGAGGCCTTGGGACCGTCTTGCTTACACTTGCTGGTCGTGagATATTCAGGAATTTTCTGTCAAGTGCAATGATTCATGCAACCCGTCCATTTGTTGTGAATGAGTGGATTAAAGCAAA...

CDS

Download CDS FASTA

813 bp · LXL04_028324|LXL04_028324|OH1004|CDS

ATGGAGAAAAACAATACCACCGATACAAGAAACATGGGGTTCCAATTTGCCGGGAAAGCTGTATACACAGCAGTATGGGTGGCTGCTGTATCACTTTTCATGGAGTTACTTGGTTTTTCTACCCAAAAATGGCTAACTGCAGGAGGCCTTGGGACCGTCTTGCTTACACTTGCTGGTCGTGAGATATTCAGGAATTTTCTGTCAAGTGCAATGATTCATGCAACCCGTCCATTTGTTGTGAATGAGTGGATTAAAGCAAA...

Protein

Download Protein FASTA

270 aa · LXL04_028324|LXL04_028324|OH1004|PROTEIN

MEKNNTTDTRNMGFQFAGKAVYTAVWVAAVSLFMELLGFSTQKWLTAGGLGTVLLTLAGREIFRNFLSSAMIHATRPFVVNEWIKAKIEGYEVSGTVEHVGWWSPTVIRGEDREAIHIPNHKFTMNVVRNMTEKTHWRIKTHLAISYLDVNKINSIVADMRKVIAKNPQVEQQRLHRRVFLENVDPENQALLILISCFVKTSHFEEYLCVKVIKHFLNLHKFILMHLFGILQMYTLTFVLNTLVSKKFRKKKEKKSVGQE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028324`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028324

Location Chr06:37801720-37803020 (-)

Description Similar to MSL2: Mechanosensitive ion channel protein 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g10490`	Mechanosensitive channel that opens in response to stretch forces in the membrane lipid bilayer (By similarity).	MscS-like proteins control plastid size and shape in Arabidopsis thaliana.2006 · DOI: 10.1016/j.cub.2005.11.044 Two mechanosensitive channel homologs influence division ring placement in Arabidopsis chloroplasts.2011 · DOI: 10.1105/tpc.111.088112
`At1g58200`	Mechanosensitive channel that opens in response to stretch forces in the membrane lipid bilayer.	MscS-like proteins control plastid size and shape in Arabidopsis thaliana.2006 · DOI: 10.1016/j.cub.2005.11.044 Two mechanosensitive channel homologs influence division ring placement in Arabidopsis chloroplasts.2011 · DOI: 10.1105/tpc.111.088112

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028324 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010020 chloroplast fission Biological Process

GO:0071470 cellular response to osmotic stress Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009526 plastid envelope Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0005216 monoatomic ion channel activity Molecular Function

GO:0008381 mechanosensitive monoatomic ion channel activity Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

aae:aq_812

ath:AT1G58200

ath:AT5G10490

ece:Z2437

ecj:JW1323

eco:b1330

ecoc:C3026_07790

ecs:ECs_1912

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.309

Rank 1 · LXL04_028324 · OH-1004

Cell membrane0.299

Rank 2 · LXL04_028324 · OH-1004

Golgi apparatus0.167

Rank 3 · LXL04_028324 · OH-1004

Cytoplasm0.159

Rank 4 · LXL04_028324 · OH-1004

Nucleus0.110

Rank 5 · LXL04_028324 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25237.1MSL2_31-60 aa

PF00924.25MS_channel_2nd62-132 aa

PF24956.1Msl2-3_C137-221 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028324	`PF25237.1`	MSL2_3	1	60	1.1e-30	107.6
LXL04_028324	`PF00924.25`	MS_channel_2nd	62	132	2.3e-11	44.4
LXL04_028324	`PF24956.1`	Msl2-3_C	137	221	6.4e-40	136.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q56X46`	Arabidopsis thaliana	Mechanosensitive ion channel protein 2, chloroplastic	79.435%	Swiss-Prot	strong database homology
`Q8L7W1`	Arabidopsis thaliana	Mechanosensitive ion channel protein 3, chloroplastic	70.155%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card