LXL04_028315 | RubberDandelionOmics

Gene overview

LXL04_028315

Reference: OH-1004 Chr: Chr06 Coordinates: 37416085-37427491 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3099 bp · LXL04_028315|LXL04_028315|OH1004|cDNA

ATGGCAATTGTGTTGGTCTATGTAGATGACTTGATCATCACGGGGGACGATGAACGAGAAATCTATCAAATAAGAGAAAATCTATCGGTGCGCTTCCAAATGAAAGAGCTTGGAGAGCTTAAACACTTCTTAGGACTAGAAGTTGATCACACAAAAGAAGGGTTGTTTCTTTGCCAACAAAAGTATATAAGAGATATATTTCAGAAGTTTGGTATGTTGGAGTGCAAGCCAGTCTCAACGCCGATAGAGCCAAATGCCAA...

CDS

Download CDS FASTA

3099 bp · LXL04_028315|LXL04_028315|OH1004|CDS

ATGGCAATTGTGTTGGTCTATGTAGATGACTTGATCATCACGGGGGACGATGAACGAGAAATCTATCAAATAAGAGAAAATCTATCGGTGCGCTTCCAAATGAAAGAGCTTGGAGAGCTTAAACACTTCTTAGGACTAGAAGTTGATCACACAAAAGAAGGGTTGTTTCTTTGCCAACAAAAGTATATAAGAGATATATTTCAGAAGTTTGGTATGTTGGAGTGCAAGCCAGTCTCAACGCCGATAGAGCCAAATGCCAA...

Protein

Download Protein FASTA

1032 aa · LXL04_028315|LXL04_028315|OH1004|PROTEIN

MAIVLVYVDDLIITGDDEREIYQIRENLSVRFQMKELGELKHFLGLEVDHTKEGLFLCQQKYIRDIFQKFGMLECKPVSTPIEPNAKICAYEGKELDDGTMYRQLVGSLIYLTLSRPDISYAVGVMSRYMQSPKKPHLDAARRILRYIKGIIDYGLLYKREEDCKLVGYCDADYAGDHDTRRSTTGYVFKLGSGPISWCSKRQPTVSLSTTEAEYRAAAVAAQESTWLVLLMKDLHQKIDYAVPLYCDNESAIRLAENPV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028315`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028315

Location Chr06:37416085-37427491 (+)

Description Similar to At3g15890: PTI1-like tyrosine-protein kinase At3g15890

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g15890`	PTI1-like tyrosine-protein kinase At3g15890.	No verified direct reference in this release
`At3g24550`	Proline-rich receptor-like protein kinase PERK1.	No verified direct reference in this release
`At3g24400`	Proline-rich receptor-like protein kinase PERK2.	No verified direct reference in this release
`At1g68690`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release
`At3g24540`	Proline-rich receptor-like protein kinase PERK3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028315 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0009611 response to wounding Biological Process

GO:0009620 response to fungus Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004715 non-membrane spanning protein tyrosine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0019901 protein kinase binding Molecular Function

KEGG gene cross-reference

ath:AT1G68690

ath:AT3G15890

ath:AT3G24550

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.534

Rank 1 · LXL04_028315 · OH-1004

Cytoplasm0.266

Rank 2 · LXL04_028315 · OH-1004

Nucleus0.207

Rank 3 · LXL04_028315 · OH-1004

Endoplasmic reticulum0.063

Rank 4 · LXL04_028315 · OH-1004

Plastid0.048

Rank 5 · LXL04_028315 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07727.20RVT_23-83 aa

PF27655.2GDU_TM409-448 aa

PF00069.32Pkinase579-847 aa

PF07714.24PK_Tyr_Ser-Thr581-849 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028315	`PF07727.20`	RVT_2	3	83	9.3e-19	68.7
LXL04_028315	`PF27655.2`	GDU_TM	409	448	2.8e-21	75.8
LXL04_028315	`PF00069.32`	Pkinase	579	847	1.4e-40	140.1
LXL04_028315	`PF07714.24`	PK_Tyr_Ser-Thr	581	849	1.5e-42	146.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LSC2`	Arabidopsis thaliana	PTI1-like tyrosine-protein kinase At3g15890	53.667%	Swiss-Prot	weak database homology
`Q9LV48`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK1	48.797%	Swiss-Prot	weak database homology
`Q9LK03`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK2	45.210%	Swiss-Prot	weak database homology
`Q9SX31`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK9	48.966%	Swiss-Prot	weak database homology
`Q1PEM5`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK3	47.766%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card