Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1023 bp · LXL04_028272|LXL04_028272|OH1004|cDNA
ATGACCACTGGTAAAGTGATATTCATCTTCATCGCCGTCGCATCATCACGTTGCTTCATCGTATTCTCCCTCCGGCTACTTTCAGGTGAACGTTTCTGTGACCTTACGCGCCTACCGTCCCGACAAGCTCTCCAATCAGATCAATTCACAGTGTTGATAAATGGTTATTCGGAATCTCGCATTCCGATCCTTCAGACGGTGTCTGGAGTGTATTCAAGCTCTCCGTCTGTAGCTGCGGTGGTAGTGTTATGGGGAAACCC...
1023 bp · LXL04_028272|LXL04_028272|OH1004|CDS
ATGACCACTGGTAAAGTGATATTCATCTTCATCGCCGTCGCATCATCACGTTGCTTCATCGTATTCTCCCTCCGGCTACTTTCAGGTGAACGTTTCTGTGACCTTACGCGCCTACCGTCCCGACAAGCTCTCCAATCAGATCAATTCACAGTGTTGATAAATGGTTATTCGGAATCTCGCATTCCGATCCTTCAGACGGTGTCTGGAGTGTATTCAAGCTCTCCGTCTGTAGCTGCGGTGGTAGTGTTATGGGGAAACCC...
Protein
Download Protein FASTA340 aa · LXL04_028272|LXL04_028272|OH1004|PROTEIN
MTTGKVIFIFIAVASSRCFIVFSLRLLSGERFCDLTRLPSRQALQSDQFTVLINGYSESRIPILQTVSGVYSSSPSVAAVVVLWGNPATPAKTLVELSHNLSISSPGDAPISVIRQPSSSLNARFLPRPWISTRAVLICDDDIEVDLKSIQFAFNIWRNNPEQLIGLFARSHELDLTSGTWIYTVHPDRYSILLTKFMLMKTEYLYQYSCEGGESMAQARSIVDEMRNCEDILMNFVAANRTRMGPVLVGAKRVRDWGDA...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_028272 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_028272 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:36513828-36514850 (-) | |||||||||
| Description | Similar to At1g80290: Glycosyltransferase family protein 64 C3 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0001503 ossification Biological Process GO:0006665 sphingolipid metabolic process Biological Process GO:0006688 glycosphingolipid biosynthetic process Biological Process GO:0009626 plant-type hypersensitive response Biological Process GO:0009737 response to abscisic acid Biological Process GO:0009738 abscisic acid-activated signaling pathway Biological Process GO:0010087 phloem or xylem histogenesis Biological Process GO:0010401 pectic galactan metabolic process Biological Process GO:0010838 positive regulation of keratinocyte proliferation Biological Process GO:0015012 heparan sulfate proteoglycan biosynthetic process Biological Process GO:0030307 positive regulation of cell growth Biological Process GO:0032496 response to lipopolysaccharide Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G80290 ath:AT3G55830 hsa:2137 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF09258.17Glyco_transf_6449-318 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_028272 | PF09258.17 | Glyco_transf_64 | 49 | 318 | 4.6e-74 | 249.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.