LXL04_028228 | RubberDandelionOmics

Gene overview

LXL04_028228

Reference: OH-1004 Chr: Chr06 Coordinates: 35277191-35281120 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1428 bp · LXL04_028228|LXL04_028228|OH1004|cDNA

ATGGCTAACATTTGCGTATGTGCGAGATTCAGGCCTCTAAATTCAAGAGAGGACGGCGAAGCTATATGCATTACACGCTCCGATTCTCAAAGTTTTTCAATCAAGGATGAGAAAGATAAACAGTATACGTTCACCTTTGACAGAGTATTTTATGAGGATTCTGAACAAGCCGACGTCTACGAACATGTTGGTCGCCCGATCGTCAGAGATGCTGTTAATTCAATTAACGGTACAATCATCACATACGGACAGACAGGAGC...

CDS

Download CDS FASTA

1428 bp · LXL04_028228|LXL04_028228|OH1004|CDS

ATGGCTAACATTTGCGTATGTGCGAGATTCAGGCCTCTAAATTCAAGAGAGGACGGCGAAGCTATATGCATTACACGCTCCGATTCTCAAAGTTTTTCAATCAAGGATGAGAAAGATAAACAGTATACGTTCACCTTTGACAGAGTATTTTATGAGGATTCTGAACAAGCCGACGTCTACGAACATGTTGGTCGCCCGATCGTCAGAGATGCTGTTAATTCAATTAACGGTACAATCATCACATACGGACAGACAGGAGC...

Protein

Download Protein FASTA

475 aa · LXL04_028228|LXL04_028228|OH1004|PROTEIN

MANICVCARFRPLNSREDGEAICITRSDSQSFSIKDEKDKQYTFTFDRVFYEDSEQADVYEHVGRPIVRDAVNSINGTIITYGQTGAGKTYTMEGGNILEADNRKKGLLPRVVDELFSAINICGETTAYEIKLSMVEIYMERVRDLFDLSKDNIQIKEHKGNGILLSGVTEILILDGEEALTNLCRGISNRAVGETQMNAESSRSHCIYIFTVQKQVTNEKRVSSGKLVLVDLAGSEKVDMTGAKGQVLEEAKSINTSLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028228`
TK1151 ID	TkA07G132280
OH-1004 ID	LXL04_028228
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.900
Protein coverage (%)	TK1151 97.024 / OH-1004 34.316 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028228

Location Chr06:35277191-35281120 (+)

Description Similar to KIN1: Kinesin-like protein KIN-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g63480`	Kinesin-like motor protein that promotes synapsis and is required for proper crossover distribution in meiosis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0117000`	Kinesin-like motor protein that exhibits microtubule- stimulated ATPase activity.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028228 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007018 microtubule-based movement Biological Process

GO:0007052 mitotic spindle organization Biological Process

GO:0007129 homologous chromosome pairing at meiosis Biological Process

GO:0009555 pollen development Biological Process

GO:0009561 megagametogenesis Biological Process

GO:0030705 cytoskeleton-dependent intracellular transport Biological Process

GO:0048316 seed development Biological Process

GO:0051231 spindle elongation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005871 kinesin complex Cellular Component

GO:0005874 microtubule Cellular Component

GO:0005875 microtubule associated complex Cellular Component

KEGG gene cross-reference

ath:AT3G63480

ddi:DDB_G0280967

dosa:Os08g0117000

ncr:NCU09730

osa:4344521

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.720

Rank 1 · LXL04_028228 · OH-1004

Nucleus0.294

Rank 2 · LXL04_028228 · OH-1004

Cell membrane0.080

Rank 3 · LXL04_028228 · OH-1004

Mitochondrion0.057

Rank 4 · LXL04_028228 · OH-1004

Golgi apparatus0.044

Rank 5 · LXL04_028228 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16796.12Microtub_bd3-146 aa

PF00225.30Kinesin9-326 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028228	`PF16796.12`	Microtub_bd	3	146	1.3e-24	87.6
LXL04_028228	`PF00225.30`	Kinesin	9	326	4.4e-101	338.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GW44`	Arabidopsis thaliana	Kinesin-like protein KIN-1	55.093%	Swiss-Prot	strong database homology
`F9W301`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-1	53.596%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card