LXL04_028141 | RubberDandelionOmics

Gene overview

LXL04_028141

Reference: OH-1004 Chr: Chr06 Coordinates: 32398309-32405624 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5721 bp · LXL04_028141|LXL04_028141|OH1004|cDNA

GTCACAGATCCAGACATCCAGTTACTTCCAATGGCTTCCAGTTCTTGGTCTAGTGTGACGAACTCTCCTGGTAGTACTGGTAGCAGCTACGATGTTTTTCTAAGCTTTAGAGGCGAAGACACCCGTCACAATTTTACGGATCATCTTTACGAAAGATTAATGAAGGCAGGAATCTTTACTTTTAGGGATGAAGAAGATATCAAGAGAGGCGAAGGAGTTAAGCCGGAGATTGAGAAAGCAATTAAAGAATCGAGGGCTTC...

CDS

Download CDS FASTA

5691 bp · LXL04_028141|LXL04_028141|OH1004|CDS

ATGGCTTCCAGTTCTTGGTCTAGTGTGACGAACTCTCCTGGTAGTACTGGTAGCAGCTACGATGTTTTTCTAAGCTTTAGAGGCGAAGACACCCGTCACAATTTTACGGATCATCTTTACGAAAGATTAATGAAGGCAGGAATCTTTACTTTTAGGGATGAAGAAGATATCAAGAGAGGCGAAGGAGTTAAGCCGGAGATTGAGAAAGCAATTAAAGAATCGAGGGCTTCCGTAGTTGTACTGTCAGAGAACTATGCAAC...

Protein

Download Protein FASTA

1896 aa · LXL04_028141|LXL04_028141|OH1004|PROTEIN

MASSSWSSVTNSPGSTGSSYDVFLSFRGEDTRHNFTDHLYERLMKAGIFTFRDEEDIKRGEGVKPEIEKAIKESRASVVVLSENYATSTWCLDELTLILKLRRESNHLVLPVFYKVEPCDVGKQNKTFAVEVKASSRWTDENVNLWKNALTEVCVISGEVLSSSTPEAECLKKIVHTIYEKLDCKKFHLPNNLSGMAARYKDVSSIINDPNVNFVAICGMGGSGKTTLAKYIYNKNWNSSENMSFLEEVGGRCKGYDDLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028141`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028141

Location Chr06:32398309-32405624 (-)

Description Similar to EXO70E2: Exocyst complex component EXO70E2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61010`	Influences the subcellular localization patterns of other exocyst complex proteins (e.g. SEC5A, SEC15A, SEC15B and EXO84B) leading to their recruitment to exocyst, well-defined large punctate structures throughout the cytosol.	EXPO, an exocyst-positive organelle distinct from multivesicular endosomes and autophagosomes, mediates cytosol to cell wall exocytosis in Arabidopsis and tobacco cells.2010 · DOI: 10.1105/tpc.110.080697 Exo70E2 is essential for exocyst subunit recruitment and EXPO formation in both plants and animals.2014 · DOI: 10.1091/mbc.e13-10-0586

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028141 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006887 exocytosis Biological Process

GO:0006952 defense response Biological Process

GO:0006955 immune response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0015031 protein transport Biological Process

GO:0019677 NAD+ catabolic process Biological Process

GO:0043068 positive regulation of programmed cell death Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0052542 defense response by callose deposition Biological Process

GO:1903533 regulation of protein targeting Biological Process

GO:1903553 positive regulation of extracellular exosome assembly Biological Process

KEGG gene cross-reference

ath:AT5G61010

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.389

Rank 1 · LXL04_028141 · OH-1004

Cell membrane0.385

Rank 2 · LXL04_028141 · OH-1004

Nucleus0.324

Rank 3 · LXL04_028141 · OH-1004

Endoplasmic reticulum0.061

Rank 4 · LXL04_028141 · OH-1004

Plastid0.046

Rank 5 · LXL04_028141 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01582.26TIR20-183 aa

PF13676.12TIR_222-120 aa

PF00931.29NB-ARC209-366 aa

PF23282.2WHD_ROQ1444-510 aa

PF20669.4Exo70_N1231-1290 aa

PF03081.23Exo70_C1412-1781 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028141	`PF01582.26`	TIR	20	183	8.5e-45	153.4
LXL04_028141	`PF13676.12`	TIR_2	22	120	2.8e-18	67.3
LXL04_028141	`PF00931.29`	NB-ARC	209	366	9.9e-18	65.0
LXL04_028141	`PF23282.2`	WHD_ROQ1	444	510	5.1e-14	52.9
LXL04_028141	`PF20669.4`	Exo70_N	1231	1290	2.2e-08	35.0
LXL04_028141	`PF03081.23`	Exo70_C	1412	1781	1.1e-109	367.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FNR3`	Arabidopsis thaliana	Exocyst complex component EXO70E2	37.049%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card