Gene Card
Gene overview
cDNA / CDS / Protein Sequences
993 bp · LXL04_028022|LXL04_028022|OH1004|cDNA
ATGACGGTCGACGACGAGAACTCCGTGTATGTCGGCAACCTGCCTTACGACGCTACTGAAGACAGTATTCGAGGTGTCTTCGATCTTTACGGCCAAGTAATCGCCGTCAAGATAATCAACGACCGTGGAGTAGGTGGAAAATGCTACGGCTTTGTAACTTTCACAAATCCCCGATCTGCAGTTGATGCCATCAATGATATGGATGGAAGGACTGTTGATGGGCGAGTAGTAAAAGTAAATGAAGTCAAAAGCAGAGGTGC...
993 bp · LXL04_028022|LXL04_028022|OH1004|CDS
ATGACGGTCGACGACGAGAACTCCGTGTATGTCGGCAACCTGCCTTACGACGCTACTGAAGACAGTATTCGAGGTGTCTTCGATCTTTACGGCCAAGTAATCGCCGTCAAGATAATCAACGACCGTGGAGTAGGTGGAAAATGCTACGGCTTTGTAACTTTCACAAATCCCCGATCTGCAGTTGATGCCATCAATGATATGGATGGAAGGACTGTTGATGGGCGAGTAGTAAAAGTAAATGAAGTCAAAAGCAGAGGTGC...
Protein
Download Protein FASTA330 aa · LXL04_028022|LXL04_028022|OH1004|PROTEIN
MTVDDENSVYVGNLPYDATEDSIRGVFDLYGQVIAVKIINDRGVGGKCYGFVTFTNPRSAVDAINDMDGRTVDGRVVKVNEVKSRGARSNIGRDSFRRNNDRDMEPNRVRDRDRDRDRDRDYGRVRDRSRDQNREWSRDHDQEKERGYDRSRERFNDRLHDQDNDMDSIEHEREKTWESDRNKYKDQTAKVQNGSDLFNDRHSREHPSGSSHGDHDNISKQLDVSRHKIEQLQKEVYRMEELVEERGDHVSKLQEKSQKL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_028022 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_028022 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:28996410-28998443 (-) | ||||||||||||
| Description | Similar to cirbp: Cold-inducible RNA-binding protein | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0009409 response to cold Biological Process GO:0016477 cell migration Biological Process GO:0045727 positive regulation of translation Biological Process GO:0048255 mRNA stabilization Biological Process GO:0060212 negative regulation of nuclear-transcribed mRNA poly(A) tail shortening Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005681 spliceosomal complex Cellular Component GO:0005686 U2 snRNP Cellular Component GO:0005737 cytoplasm Cellular Component GO:0016607 nuclear speck Cellular Component | ||||||||||||
| KEGG gene cross-reference | ath:AT3G47120 dosa:Os03g0826400 xla:379484 xtr:549982 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00076.29RRM_19-78 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_028022 | PF00076.29 | RRM_1 | 9 | 78 | 5.6e-19 | 68.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.