LXL04_028005 | RubberDandelionOmics

Gene overview

LXL04_028005

Reference: OH-1004 Chr: Chr06 Coordinates: 28486643-28489330 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1233 bp · LXL04_028005|LXL04_028005|OH1004|cDNA

ATGACTATAGCAAGACTAGAAAGTGGAATGGAGGACATGTCAACATCAACATCAACATCAAACAGTATTAGCAATCGGTATGCAAAGCTGTTAGAGGGTTCATGGTTGACCCAGTTCCGCCATGGATCCAACCCGTGGATGGCCAGATACGTTTACAGTGTCCTGTTTCTTTTAGCAAATTTACTCGCATGGGCTGTTCGCGACTATGGACCTAGTGCTTTGACCGAAATGAAGCGATTGAAAAGTTGTAAAGGTGGTAA...

CDS

Download CDS FASTA

1233 bp · LXL04_028005|LXL04_028005|OH1004|CDS

ATGACTATAGCAAGACTAGAAAGTGGAATGGAGGACATGTCAACATCAACATCAACATCAAACAGTATTAGCAATCGGTATGCAAAGCTGTTAGAGGGTTCATGGTTGACCCAGTTCCGCCATGGATCCAACCCGTGGATGGCCAGATACGTTTACAGTGTCCTGTTTCTTTTAGCAAATTTACTCGCATGGGCTGTTCGCGACTATGGACCTAGTGCTTTGACCGAAATGAAGCGATTGAAAAGTTGTAAAGGTGGTAA...

Protein

Download Protein FASTA

410 aa · LXL04_028005|LXL04_028005|OH1004|PROTEIN

MTIARLESGMEDMSTSTSTSNSISNRYAKLLEGSWLTQFRHGSNPWMARYVYSVLFLLANLLAWAVRDYGPSALTEMKRLKSCKGGKECLGTEGVLRVSMGCFIFYLTMFISTAGTSRLHVRKELWHSGWWSAKVFLMIALTVFPFFLPPEMILIYGDVAHFGAGVFLLIQLISIISFITWLNDCCLSEKYAARCHIHSMLLATAAYIVSILGIILMYIWYTPQPSCLLNIFFITWTLVLLQLMTSVSLHPKISAGFLTP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028005`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_028005`
Location	Chr06:28486643-28489330 (+)
Description	Similar to serinc: Probable serine incorporator
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_028005` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006563 L-serine metabolic process Biological Process GO:0006658 phosphatidylserine metabolic process Biological Process GO:0006665 sphingolipid metabolic process Biological Process GO:0008654 phospholipid biosynthetic process Biological Process GO:0017121 plasma membrane phospholipid scrambling Biological Process GO:0044091 membrane biogenesis Biological Process GO:0140374 antiviral innate immune response Biological Process GO:0000139 Golgi membrane Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005886 plasma membrane Cellular Component GO:0016020 membrane Cellular Component GO:0048471 perinuclear region of cytoplasm Cellular Component
KEGG gene cross-reference	ddi:DDB_G0281099 hsa:10955 mmu:56442 pon:100173651 rno:294421 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.643

Rank 1 · LXL04_028005 · OH-1004

Cytoplasm0.182

Rank 2 · LXL04_028005 · OH-1004

Endoplasmic reticulum0.135

Rank 3 · LXL04_028005 · OH-1004

Lysosome / Vacuole0.126

Rank 4 · LXL04_028005 · OH-1004

Golgi apparatus0.073

Rank 5 · LXL04_028005 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03348.22Serinc42-326 aa

PF03348.22Serinc324-404 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028005	`PF03348.22`	Serinc	42	326	7.3e-73	246.7
LXL04_028005	`PF03348.22`	Serinc	324	404	7.3e-73	246.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card