LXL04_027886 | RubberDandelionOmics

Gene overview

LXL04_027886

Reference: OH-1004 Chr: Chr06 Coordinates: 25666482-25683227 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4404 bp · LXL04_027886|LXL04_027886|OH1004|cDNA

ATGGCTCGTGTGTTCATTCTTCTGGCTCTCTTTTTCTCCGTGGCAATGGCAGCTGACCATAGCCCCCTTCAAGACTTCTGTGTTGCAGACATGAACAGTCAAGTTACGGTGAACGGATTCACTTGCAAAAACCCGAATATGGTTCAAGGCAACGACTTCTACTTTAGTGGACTACACATGATGGGAAATACCTCGAACTTCCTTGGGTCTAGGGTGACCCCGGTTTTTGTTACACAATTGGCAGGACTTAACACTTTGGG...

CDS

Download CDS FASTA

4404 bp · LXL04_027886|LXL04_027886|OH1004|CDS

ATGGCTCGTGTGTTCATTCTTCTGGCTCTCTTTTTCTCCGTGGCAATGGCAGCTGACCATAGCCCCCTTCAAGACTTCTGTGTTGCAGACATGAACAGTCAAGTTACGGTGAACGGATTCACTTGCAAAAACCCGAATATGGTTCAAGGCAACGACTTCTACTTTAGTGGACTACACATGATGGGAAATACCTCGAACTTCCTTGGGTCTAGGGTGACCCCGGTTTTTGTTACACAATTGGCAGGACTTAACACTTTGGG...

Protein

Download Protein FASTA

1467 aa · LXL04_027886|LXL04_027886|OH1004|PROTEIN

MARVFILLALFFSVAMAADHSPLQDFCVADMNSQVTVNGFTCKNPNMVQGNDFYFSGLHMMGNTSNFLGSRVTPVFVTQLAGLNTLGISMARIDYAPWGINPPHTHPRATEILTVLEGSLEVGFVTSNPENRHITKVLNKGDVFVFPVNLVHYQRNVGKTNVVAIAALSSQNPGVIPIANVVFGSKPDISTDILAKAFQASDDVVRDMQIKFDVYPSSRTQSTNLPWDKTAVYIHNISIINSLLSHPFDLSMARILILLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027886`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027886

Location Chr06:25666482-25683227 (+)

Description Similar to Os02g0491600: Putative germin-like protein 2-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g39110`	May play a role in plant defense.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0491600`	May play a role in plant defense.	No verified direct reference in this release
`Os02g0491700`	May play a role in plant defense.	No verified direct reference in this release
`Os02g0491800`	May play a role in plant defense.	No verified direct reference in this release
`Os08g0189100`	Plays a role in broad-spectrum disease resistance.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027886 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0048046 apoplast Cellular Component

GO:0030145 manganese ion binding Molecular Function

KEGG gene cross-reference

dosa:Os02g0491600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.551

Rank 1 · LXL04_027886 · OH-1004

Lysosome / Vacuole0.304

Rank 2 · LXL04_027886 · OH-1004

Nucleus0.173

Rank 3 · LXL04_027886 · OH-1004

Endoplasmic reticulum0.118

Rank 4 · LXL04_027886 · OH-1004

Extracellular0.107

Rank 5 · LXL04_027886 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00190.29Cupin_160-205 aa

PF07883.18Cupin_293-165 aa

PF00190.29Cupin_1311-455 aa

PF07883.18Cupin_2344-416 aa

PF00190.29Cupin_1562-706 aa

PF07883.18Cupin_2595-667 aa

PF00190.29Cupin_1813-957 aa

PF07883.18Cupin_2846-918 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027886	`PF00190.29`	Cupin_1	60	205	2.7e-285	933.4
LXL04_027886	`PF07883.18`	Cupin_2	93	165	1.4e-63	211.2
LXL04_027886	`PF00190.29`	Cupin_1	311	455	2.7e-285	933.4
LXL04_027886	`PF07883.18`	Cupin_2	344	416	1.4e-63	211.2
LXL04_027886	`PF00190.29`	Cupin_1	562	706	2.7e-285	933.4
LXL04_027886	`PF07883.18`	Cupin_2	595	667	1.4e-63	211.2
LXL04_027886	`PF00190.29`	Cupin_1	813	957	2.7e-285	933.4
LXL04_027886	`PF07883.18`	Cupin_2	846	918	1.4e-63	211.2
LXL04_027886	`PF00190.29`	Cupin_1	1064	1208	2.7e-285	933.4
LXL04_027886	`PF07883.18`	Cupin_2	1097	1169	1.4e-63	211.2
LXL04_027886	`PF00190.29`	Cupin_1	1315	1458	2.7e-285	933.4
LXL04_027886	`PF07883.18`	Cupin_2	1348	1420	1.4e-63	211.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FID0`	Arabidopsis thaliana	Germin-like protein subfamily 1 member 14	59.633%	Swiss-Prot	weak database homology
`Q6K5Q0`	Oryza sativa subsp. japonica	Putative germin-like protein 2-1	67.943%	Swiss-Prot	weak database homology
`Q6K5P9`	Oryza sativa subsp. japonica	Putative germin-like protein 2-2	65.116%	Swiss-Prot	weak database homology
`Q6K5P8`	Oryza sativa subsp. japonica	Putative germin-like protein 2-3	69.036%	Swiss-Prot	weak database homology
`Q6YZA9`	Oryza sativa subsp. japonica	Germin-like protein 8-2	65.000%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card