LXL04_027685 | RubberDandelionOmics

Gene overview

LXL04_027685

Reference: OH-1004 Chr: Chr06 Coordinates: 21740277-21742521 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

879 bp · LXL04_027685|LXL04_027685|OH1004|cDNA

ATGGCTCACACTATACTAAAAATTCCATTTCTCTCAACTATCACCACAGCTGCGGTTAAATTCTCCAAATCATCGCTTCATGGTAATGGCCGCCGTATCTGTCAATGTTCATCACCTCTATCCACTTCTCAAGTTCAACAACGACAACCGCAAATCAGAAGCCCTCAACTCGTCGCATTGGAGTATGCTGATCTTAGCATACCGCATATCGTGTGCGAGGAGTTGGGTGCTACTAGGGTGAGGCAGCATGTTAACCCTCT...

CDS

Download CDS FASTA

879 bp · LXL04_027685|LXL04_027685|OH1004|CDS

ATGGCTCACACTATACTAAAAATTCCATTTCTCTCAACTATCACCACAGCTGCGGTTAAATTCTCCAAATCATCGCTTCATGGTAATGGCCGCCGTATCTGTCAATGTTCATCACCTCTATCCACTTCTCAAGTTCAACAACGACAACCGCAAATCAGAAGCCCTCAACTCGTCGCATTGGAGTATGCTGATCTTAGCATACCGCATATCGTGTGCGAGGAGTTGGGTGCTACTAGGGTGAGGCAGCATGTTAACCCTCT...

Protein

Download Protein FASTA

292 aa · LXL04_027685|LXL04_027685|OH1004|PROTEIN

MAHTILKIPFLSTITTAAVKFSKSSLHGNGRRICQCSSPLSTSQVQQRQPQIRSPQLVALEYADLSIPHIVCEELGATRVRQHVNPLSSTLSFPVEVPDWNDVFEDPNLPLVVDIGSGSGRFVMWLAKRNHGSKNYMGLEIRKKLVTRAEKWAKELALNNIHFVFANATISFKELISTYPGPLMLVSILCPDPHFKKRHHKRRIIQKPLVEAITDTLMPGGHVFIQSDVLEVAIDMRNYFDAESAKLVFESDLESDNEGW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027685`
TK1151 ID	TkA07G085450
OH-1004 ID	LXL04_027685
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_027685`
Location	Chr06:21740277-21742521 (+)
Description	Similar to trmB: tRNA (guanine-N(7)-)-methyltransferase (Synechocystis sp. (strain PCC 6803 / Kazusa)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_027685` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0030488 tRNA methylation Biological Process GO:0036265 RNA (guanine-N7)-methylation Biological Process GO:0043527 tRNA methyltransferase complex Cellular Component GO:0008176 tRNA (guanine(46)-N7)-methyltransferase activity Molecular Function
KEGG gene cross-reference	cya:CYA_2671 cyb:CYB_2166 syc:syc1155_d syf:Synpcc7942_0358 syn:sll1300 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.832

Rank 1 · LXL04_027685 · OH-1004

Mitochondrion0.121

Rank 2 · LXL04_027685 · OH-1004

Cytoplasm0.102

Rank 3 · LXL04_027685 · OH-1004

Nucleus0.080

Rank 4 · LXL04_027685 · OH-1004

Peroxisome0.042

Rank 5 · LXL04_027685 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02390.24Methyltransf_4110-285 aa

PF13847.13Methyltransf_31112-169 aa

PF13649.13Methyltransf_25112-168 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027685	`PF02390.24`	Methyltransf_4	110	285	4.9e-35	121.3
LXL04_027685	`PF13847.13`	Methyltransf_31	112	169	1.9e-07	31.7
LXL04_027685	`PF13649.13`	Methyltransf_25	112	168	1.6e-06	29.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card