LXL04_027631 | RubberDandelionOmics

Gene overview

LXL04_027631

Reference: OH-1004 Chr: Chr06 Coordinates: 20679157-20691128 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4750 bp · LXL04_027631|LXL04_027631|OH1004|cDNA

ATGTGTCACCGTTCAACATATACCttcgtctctctctctctcccacaCAAAAACCTTCGCTCGGTCCACTCTCGCTTTTCACATTTTATCGACAGAAACAGAGATCCAAGGAGTTGGAACTTGGAACAAGTCTCCCTGCATTTCGATTCACACTTCTCGCATTGAAGTTTCACTGCAACAGATATCATTTCATCAAATTCAACTTCTTCCTTCGTCTCAGACCGCATCAGCTTTTAGTAATTGAAGCGGCCATCGAGCTT...

CDS

Download CDS FASTA

4479 bp · LXL04_027631|LXL04_027631|OH1004|CDS

ATGGAAGAGGAAAATGAAGTGGAGCTTTTACAAAGGTACAGGCGAGATAGGCGGATACTTCTTAATTACTTACTATCTGGTAGTTTGATTAAGAAAGTTGTGATGCCACCTGGTGCTGTGTCGTTGGATGATGTGGATCTAGATCAAGTTAGTGTTGATTTTGTGCTAAATTCCGTGAAAAAAGGTGACATGCTTGAGCTCTCAGAAGCTATTAGAGAATATCATGATAGTACTGGATACCCTCATATGACTGCAGAGTC...

Protein

Download Protein FASTA

1492 aa · LXL04_027631|LXL04_027631|OH1004|PROTEIN

MEEENEVELLQRYRRDRRILLNYLLSGSLIKKVVMPPGAVSLDDVDLDQVSVDFVLNSVKKGDMLELSEAIREYHDSTGYPHMTAESEGEFFLATNPDSSGSPPKRAPPAVPFVAASPIVSDIASLPFEATEEDEPTISNSKSFNSGQPQNLTVDDIDDFEDDDDLEELNSRRYSRRTMNDTADLIVGLPPFATGITDDDLRETAYEILLAAAGASGGLIVPSKGKKKEKKSGLLKKLGRSKSEQVTMQSQQSTGLTGLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027631`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027631

Location Chr06:20679157-20691128 (+)

Description Similar to PATROL1: Protein unc-13 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g06970`	Controls the tethering of the proton ATPase AHA1 to the plasma membrane.	A Munc13-like protein in Arabidopsis mediates H+-ATPase translocation that is essential for stomatal responses.2013 · DOI: 10.1038/ncomms3215
`At3g07940`	GTPase-activating protein (GAP) for ADP ribosylation factor (ARF).	No verified direct reference in this release
`At4g21160`	GTPase-activating protein (GAP) for ADP ribosylation factor (ARF).	No verified direct reference in this release
`At4g05330`	GTPase-activating protein (GAP) for ADP ribosylation factor (ARF).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0327000`	Mediates the transient calcium-dependent interaction of PYR/PYL/RCAR abscisic acid (ABA) receptors with the plasma membrane and thus regulates ABA sensitivity (By similarity).	Constitutive expression of a rice GTPase-activating protein induces defense responses.2008 · DOI: 10.1111/j.1469-8137.2008.02473.x An ancient P-loop GTPase in rice is regulated by a higher plant-specific regulatory protein.2010 · DOI: 10.1074/jbc.m110.172080 Site-directed Mutagenesis Shows the Significance of Interactions with Phospholipids and the G-protein OsYchF1 for the Physiological Functions of the Rice GTPase-activating Protein 1 (OsGAP1).2015 · DOI: 10.1074/jbc.m115.655639

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027631 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006952 defense response Biological Process

GO:0009555 pollen development Biological Process

GO:0009611 response to wounding Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0010118 stomatal movement Biological Process

GO:0043547 positive regulation of GTPase activity Biological Process

GO:0072659 protein localization to plasma membrane Biological Process

GO:1900426 positive regulation of defense response to bacterium Biological Process

GO:1901002 positive regulation of response to salt stress Biological Process

GO:0000325 plant-type vacuole Cellular Component

KEGG gene cross-reference

ath:AT3G07940

ath:AT4G05330

ath:AT4G21160

ath:AT5G06970

dosa:Os02g0327000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.428

Rank 1 · LXL04_027631 · OH-1004

Cytoplasm0.329

Rank 2 · LXL04_027631 · OH-1004

Nucleus0.219

Rank 3 · LXL04_027631 · OH-1004

Golgi apparatus0.131

Rank 4 · LXL04_027631 · OH-1004

Endoplasmic reticulum0.102

Rank 5 · LXL04_027631 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27630.1UNC13_N9-77 aa

PF27629.1UNC13_3rd451-568 aa

PF25761.2TPR_PATROL1712-1094 aa

PF01412.24ArfGap1154-1267 aa

PF00168.37C21338-1426 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027631	`PF27630.1`	UNC13_N	9	77	6.3e-30	103.4
LXL04_027631	`PF27629.1`	UNC13_3rd	451	568	8.5e-43	146.1
LXL04_027631	`PF25761.2`	TPR_PATROL1	712	1094	4.4e-129	431.7
LXL04_027631	`PF01412.24`	ArfGap	1154	1267	2e-36	125.3
LXL04_027631	`PF00168.37`	C2	1338	1426	2.2e-21	76.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RX56`	Arabidopsis thaliana	Protein unc-13 homolog	66.937%	Swiss-Prot	strong database homology
`Q8L7A4`	Arabidopsis thaliana	Probable ADP-ribosylation factor GTPase-activating protein AGD11	53.600%	Swiss-Prot	weak database homology
`Q9FVJ3`	Arabidopsis thaliana	ADP-ribosylation factor GTPase-activating protein AGD12	46.132%	Swiss-Prot	weak database homology
`Q8LFN9`	Arabidopsis thaliana	Probable ADP-ribosylation factor GTPase-activating protein AGD13	44.058%	Swiss-Prot	weak database homology
`Q6YWF1`	Oryza sativa subsp. japonica	GTPase activating protein 1	47.170%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card