LXL04_027490 | RubberDandelionOmics

Gene overview

LXL04_027490

Reference: OH-1004 Chr: Chr06 Coordinates: 17138916-17141744 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1491 bp · LXL04_027490|LXL04_027490|OH1004|cDNA

ATGGTTTCCTCGATTCTTCTTCAGCAATCCATTAATTGCTTCATCTACAACCACCAGCAACTGGGGAAGAATTTGAAGAATGGATTGGCGGCAACGAAGCCCAATTTGATGGAGAAATGTACCTGTAGTAGGAGAATCGGAGGCATTAAAGCTAGAGCTGCGTTTGATACTATGGAGACTGCTACTTCTCCTACTGCTTTCCCCTTCTTCCAAACCGATTCGCAACAAGAAGCCACACCTGCTTCTAAGTTGGAGCTCGC...

CDS

Download CDS FASTA

1491 bp · LXL04_027490|LXL04_027490|OH1004|CDS

ATGGTTTCCTCGATTCTTCTTCAGCAATCCATTAATTGCTTCATCTACAACCACCAGCAACTGGGGAAGAATTTGAAGAATGGATTGGCGGCAACGAAGCCCAATTTGATGGAGAAATGTACCTGTAGTAGGAGAATCGGAGGCATTAAAGCTAGAGCTGCGTTTGATACTATGGAGACTGCTACTTCTCCTACTGCTTTCCCCTTCTTCCAAACCGATTCGCAACAAGAAGCCACACCTGCTTCTAAGTTGGAGCTCGC...

Protein

Download Protein FASTA

496 aa · LXL04_027490|LXL04_027490|OH1004|PROTEIN

MVSSILLQQSINCFIYNHQQLGKNLKNGLAATKPNLMEKCTCSRRIGGIKARAAFDTMETATSPTAFPFFQTDSQQEATPASKLELADPEFYKMGFVRSMRAYGVEFREGPDGFGVYASKDIEPTRRAKVVMEIPLELMLTISQKTPWMFFPDIIPIGHPIFDVINSTNPETDWDLRLACLLLYAFDHDKNFWQLYGDFLPSADECTSLLLATEEDLMELHDEDLASTMRKERSRVLDFWIKNWHSNMPLKVKRLARDPE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027490`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027490

Location Chr06:17138916-17141744 (-)

Description Similar to PTAC14: Protein PLASTID TRANSCRIPTIONALLY ACTIVE 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g20130`	Essential for chloroplast development, especially for thylakoid formation.	A functional component of the transcriptionally active chromosome complex, Arabidopsis pTAC14, interacts with pTAC12/HEMERA and regulates plastid gene expression.2011 · DOI: 10.1104/pp.111.184762

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027490 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0032259 methylation Biological Process

GO:0032760 positive regulation of tumor necrosis factor production Biological Process

GO:0042793 plastid transcription Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0071863 regulation of cell proliferation in bone marrow Biological Process

GO:0000427 plastid-encoded plastid RNA polymerase complex Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT4G20130

mmu:224440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.964

Rank 1 · LXL04_027490 · OH-1004

Mitochondrion0.049

Rank 2 · LXL04_027490 · OH-1004

Nucleus0.022

Rank 3 · LXL04_027490 · OH-1004

Cytoplasm0.020

Rank 4 · LXL04_027490 · OH-1004

Peroxisome0.012

Rank 5 · LXL04_027490 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00856.34SET113-336 aa

PF09273.17Rubis-subs-bind424-477 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027490	`PF00856.34`	SET	113	336	5e-13	50.1
LXL04_027490	`PF09273.17`	Rubis-subs-bind	424	477	2.7e-06	28.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84JF5`	Arabidopsis thaliana	Protein PLASTID TRANSCRIPTIONALLY ACTIVE 14	62.450%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card