LXL04_027391 | RubberDandelionOmics

Gene overview

LXL04_027391

Reference: OH-1004 Chr: Chr06 Coordinates: 14803764-14811420 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1638 bp · LXL04_027391|LXL04_027391|OH1004|cDNA

ATGGCTCGAACATGTTATGCTCTGTTCATGCTACTGGTTCTATTTACGTCTTCCACAAACTGCCGGAAACTGTCAGACAGGAGGGAAGCATCTCCGGTGGAAATGAGTTTATACCTAACAGCTCTTCCAAAGGGCACTGTTCCGGCTTCTACTCCGAGCCAAAAGGGTCATGCATCAATAACCGACGAGAAGCTCATCACCCGCCACCTCATTGCCATAGACCGGATCCTCCGCTCTGTTCCCAtggggtacccgcgcga...

CDS

Download CDS FASTA

1638 bp · LXL04_027391|LXL04_027391|OH1004|CDS

ATGGCTCGAACATGTTATGCTCTGTTCATGCTACTGGTTCTATTTACGTCTTCCACAAACTGCCGGAAACTGTCAGACAGGAGGGAAGCATCTCCGGTGGAAATGAGTTTATACCTAACAGCTCTTCCAAAGGGCACTGTTCCGGCTTCTACTCCGAGCCAAAAGGGTCATGCATCAATAACCGACGAGAAGCTCATCACCCGCCACCTCATTGCCATAGACCGGATCCTCCGCTCTGTTCCCATGGGGTACCCGCGCGA...

Protein

Download Protein FASTA

545 aa · LXL04_027391|LXL04_027391|OH1004|PROTEIN

MARTCYALFMLLVLFTSSTNCRKLSDRREASPVEMSLYLTALPKGTVPASTPSQKGHASITDEKLITRHLIAIDRILRSVPMGYPRDAPATVLFGEWFRFGKPSDQKFLFEKTSFPRVHNFPIYAGTARSGNRVYVSSGKVAERKTKEIEIKSILCIPHEIRSRDGCGAKIEIKSILFKSRLGVDGIGMESAIHRNRNASGNDCDRVWDRLLQSENLKIAPLKIVQRRAEERAEEHLKWNQRRRARAEEMEMIEAVQVVT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027391`
TK1151 ID	TkA03G467470
OH-1004 ID	LXL04_027391
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	56.800
Protein coverage (%)	TK1151 53.506 / OH-1004 26.789 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027391

Location Chr06:14803764-14811420 (+)

Description Similar to CEP14: Precursor of CEP14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29290`	Extracellular signaling peptide that may regulate primary root growth rate and systemic nitrogen (N)-demand signaling.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027391 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0010037 response to carbon dioxide Biological Process

GO:1902025 nitrate import Biological Process

GO:2000280 regulation of root development Biological Process

GO:0048046 apoplast Cellular Component

GO:0005179 hormone activity Molecular Function

KEGG gene cross-reference

ath:AT1G29290

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.353

Rank 1 · LXL04_027391 · OH-1004

Cytoplasm0.292

Rank 2 · LXL04_027391 · OH-1004

Cell membrane0.210

Rank 3 · LXL04_027391 · OH-1004

Endoplasmic reticulum0.098

Rank 4 · LXL04_027391 · OH-1004

Plastid0.083

Rank 5 · LXL04_027391 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27884.1IDL55-58 aa

PF13966.12zf-RVT319-382 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027391	`PF27884.1`	IDL5	5	58	8.8e-08	33.2
LXL04_027391	`PF13966.12`	zf-RVT	319	382	1.3e-11	45.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q52K95`	Arabidopsis thaliana	Precursor of CEP14	62.791%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card