LXL04_026901 | RubberDandelionOmics

Gene overview

LXL04_026901

Reference: OH-1004 Chr: Chr06 Coordinates: 4992609-4997537 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2250 bp · LXL04_026901|LXL04_026901|OH1004|cDNA

ATGGCTGGATCTCGATCGTCTACGACGCGCCTACTCTATACTCTACGTTCATCCATATATCCATCATCGAGATCACCATCACCAATCACTGCTCTCCTCCATCTCCACCGTCACTACGCCGCTGCACCAGCCGTGAGAGCGAAAGATGATAAGGAGCCATGGTGGAAGGAGTCGATGGAGAAAGTGAGAAATATCGGAATATCAGCTCATATTGATTCGGGAAAAACAACGCTTACGGAAAGGGTTTTGTTTTACACGGG...

CDS

Download CDS FASTA

2250 bp · LXL04_026901|LXL04_026901|OH1004|CDS

ATGGCTGGATCTCGATCGTCTACGACGCGCCTACTCTATACTCTACGTTCATCCATATATCCATCATCGAGATCACCATCACCAATCACTGCTCTCCTCCATCTCCACCGTCACTACGCCGCTGCACCAGCCGTGAGAGCGAAAGATGATAAGGAGCCATGGTGGAAGGAGTCGATGGAGAAAGTGAGAAATATCGGAATATCAGCTCATATTGATTCGGGAAAAACAACGCTTACGGAAAGGGTTTTGTTTTACACGGG...

Protein

Download Protein FASTA

749 aa · LXL04_026901|LXL04_026901|OH1004|PROTEIN

MAGSRSSTTRLLYTLRSSIYPSSRSPSPITALLHLHRHYAAAPAVRAKDDKEPWWKESMEKVRNIGISAHIDSGKTTLTERVLFYTGRIHEIHEVRGKDGVGAKMDSMELEREKGITIQSAATYCTWKDYQVNIIDTPGHVDFTIEVERALRVLDGAILVLCSVGGVQSQSITVDRQMKRYEVPRVAFINKLDRMGADPWKVLNQARKKLRHHSAAVQMPIGLEEDFQGLVDLVQLKAYYFHGSSGEKVVTEEIPADLQA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026901`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026901

Location Chr06:4992609-4997537 (-)

Description Similar to MEFG2: Elongation factor G-2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45030`	Mitochondrial GTPase that catalyzes the GTP-dependent ribosomal translocation step during translation elongation.	No verified direct reference in this release
`At1g45332`	Mitochondrial GTPase that catalyzes the GTP-dependent ribosomal translocation step during translation elongation.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0565500`	Mitochondrial GTPase that catalyzes the GTP-dependent ribosomal translocation step during translation elongation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026901 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0070125 mitochondrial translational elongation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003746 translation elongation factor activity Molecular Function

GO:0003924 GTPase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0005525 GTP binding Molecular Function

KEGG gene cross-reference

ath:AT1G45332

ath:AT2G45030

dosa:Os03g0565500

mxa:MXAN_2408

spo:2539776

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.900

Rank 1 · LXL04_026901 · OH-1004

Cytoplasm0.067

Rank 2 · LXL04_026901 · OH-1004

Plastid0.047

Rank 3 · LXL04_026901 · OH-1004

Nucleus0.044

Rank 4 · LXL04_026901 · OH-1004

Cell membrane0.021

Rank 5 · LXL04_026901 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00009.34GTP_EFTU61-334 aa

PF22042.3EF-G_D2375-443 aa

PF03144.32GTP_EFTU_D2376-442 aa

PF14492.13EFG_III455-529 aa

PF16658.12RF3_C470-543 aa

PF03764.25EFG_IV530-650 aa

PF00679.31EFG_C654-739 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026901	`PF00009.34`	GTP_EFTU	61	334	1e-60	205.3
LXL04_026901	`PF22042.3`	EF-G_D2	375	443	3e-10	40.8
LXL04_026901	`PF03144.32`	GTP_EFTU_D2	376	442	2.1e-13	51.2
LXL04_026901	`PF14492.13`	EFG_III	455	529	1.6e-30	105.7
LXL04_026901	`PF16658.12`	RF3_C	470	543	4.9e-07	30.3
LXL04_026901	`PF03764.25`	EFG_IV	530	650	5.7e-39	133.4
LXL04_026901	`PF00679.31`	EFG_C	654	739	1.4e-26	93.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IW10`	Arabidopsis thaliana	Elongation factor G-2, mitochondrial	81.452%	Swiss-Prot	strong database homology
`Q9C641`	Arabidopsis thaliana	Elongation factor G-1, mitochondrial	81.511%	Swiss-Prot	strong database homology
`Q9FE64`	Oryza sativa subsp. japonica	Elongation factor G, mitochondrial	79.073%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card