Gene Card
Gene overview
cDNA / CDS / Protein Sequences
348 bp · LXL04_026797|LXL04_026797|OH1004|cDNA
ATGTTGCAGAGCAAAACCATGGCCAGAATCTACATCGAAGCAGAAAACACAATCAATTACTCCGACGTATTCAAACGAATCGCGGCAAACGCCCCTGTACCTATGAGCCCTCTCGAAAGCTTAGCTTCTGCGGCAGTCCGAACCGCAAACTCATCAAGAGCAACCCTAATTTTGGTTCTAACAAGAGGCGGAGCACCGCGAAGCTGTGATGAAACGCGGGCGAGACATAGTTTGATTTTTAGGGGTTTGGTTCCGGTTTT...
348 bp · LXL04_026797|LXL04_026797|OH1004|CDS
ATGTTGCAGAGCAAAACCATGGCCAGAATCTACATCGAAGCAGAAAACACAATCAATTACTCCGACGTATTCAAACGAATCGCGGCAAACGCCCCTGTACCTATGAGCCCTCTCGAAAGCTTAGCTTCTGCGGCAGTCCGAACCGCAAACTCATCAAGAGCAACCCTAATTTTGGTTCTAACAAGAGGCGGAGCACCGCGAAGCTGTGATGAAACGCGGGCGAGACATAGTTTGATTTTTAGGGGTTTGGTTCCGGTTTT...
Protein
Download Protein FASTA115 aa · LXL04_026797|LXL04_026797|OH1004|PROTEIN
MLQSKTMARIYIEAENTINYSDVFKRIAANAPVPMSPLESLASAAVRTANSSRATLILVLTRGGAPRSCDETRARHSLIFRGLVPVLSAGSAKASHAELTEEALEFALQHAKEKG
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_026797 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_026797 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:3062725-3063155 (+) | ||||||||||||
| Description | Similar to Pyruvate kinase, cytosolic isozyme | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006096 glycolytic process Biological Process GO:0006950 response to stress Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0000287 magnesium ion binding Molecular Function GO:0004743 pyruvate kinase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0016301 kinase activity Molecular Function GO:0030955 potassium ion binding Molecular Function | ||||||||||||
| KEGG gene cross-reference | ath:AT4G26390 dosa:Os12g0145700 gmx:547791 nta:107797877 sot:102601328 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.