LXL04_026787 | RubberDandelionOmics

Gene overview

LXL04_026787

Reference: OH-1004 Chr: Chr06 Coordinates: 2878838-2883465 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1704 bp · LXL04_026787|LXL04_026787|OH1004|cDNA

ATGGCAGCGGCCGCCGATCTCAAACGCCCTCTGATTCTACCGTCTGTAAGGGACCCCAGCGCCCTCACGCATACCTTCACCGATGACAACTCTCCGTCGCAAGTCGCCATAACCATCAACGATCAAGCGGGCTATTTCCAACCTGCAAAGCAATATTCGAGTCGTTTCGCGACCCAATCGAATGCTGATAATGATTCAACGAGAACAGATGAGAACCCTTATGCGATTATCGGGTCTGATGGATTTGAAGCGTCTGGGTC...

CDS

Download CDS FASTA

1704 bp · LXL04_026787|LXL04_026787|OH1004|CDS

ATGGCAGCGGCCGCCGATCTCAAACGCCCTCTGATTCTACCGTCTGTAAGGGACCCCAGCGCCCTCACGCATACCTTCACCGATGACAACTCTCCGTCGCAAGTCGCCATAACCATCAACGATCAAGCGGGCTATTTCCAACCTGCAAAGCAATATTCGAGTCGTTTCGCGACCCAATCGAATGCTGATAATGATTCAACGAGAACAGATGAGAACCCTTATGCGATTATCGGGTCTGATGGATTTGAAGCGTCTGGGTC...

Protein

Download Protein FASTA

567 aa · LXL04_026787|LXL04_026787|OH1004|PROTEIN

MAAAADLKRPLILPSVRDPSALTHTFTDDNSPSQVAITINDQAGYFQPAKQYSSRFATQSNADNDSTRTDENPYAIIGSDGFEASGSSTVDPFKNQTAKIEGVYEWMKMVICIPIALVRLVLFGLCIIIGYIATKFALQGWKDNQNAMPRWRCRVMWITRLCARGILFSFGYHWIIRKGKPAKREAAPIIVANHVSYIDPIYFFYECSPTIVAAESHDSMPFVGTIIRAMQVIYVNRFSYQSRKHAVHEIKRKASGNNFP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026787`
TK1151 ID	TkA07G007440
OH-1004 ID	LXL04_026787
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 73.607 / OH-1004 44.268 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026787

Location Chr06:2878838-2883465 (+)

Description Similar to LPEAT2: Lysophospholipid acyltransferase LPEAT2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45670`	Possesses acyl-CoA-dependent lysophospholipid acyltransferase activity with a subset of lysophospholipids as substrates.	Characterization of two Arabidopsis thaliana acyltransferases with preference for lysophosphatidylethanolamine.2009 · DOI: 10.1186/1471-2229-9-60 Acyl-CoA:Lysophosphatidylethanolamine Acyltransferase Activity Regulates Growth of Arabidopsis.2017 · DOI: 10.1104/pp.17.00391

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026787 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000038 very long-chain fatty acid metabolic process Biological Process

GO:0006644 phospholipid metabolic process Biological Process

GO:0006663 platelet activating factor biosynthetic process Biological Process

GO:0008654 phospholipid biosynthetic process Biological Process

GO:0030258 lipid modification Biological Process

GO:0036151 phosphatidylcholine acyl-chain remodeling Biological Process

GO:0061024 membrane organization Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005795 Golgi stack Cellular Component

KEGG gene cross-reference

ath:AT2G45670

dme:Dmel_CG32699

dre:555969

hsa:54947

mmu:270084

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.332

Rank 1 · LXL04_026787 · OH-1004

Golgi apparatus0.230

Rank 2 · LXL04_026787 · OH-1004

Cell membrane0.183

Rank 3 · LXL04_026787 · OH-1004

Cytoplasm0.164

Rank 4 · LXL04_026787 · OH-1004

Lysosome / Vacuole0.125

Rank 5 · LXL04_026787 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01553.27Acyltransferase183-296 aa

PF13499.13EF-hand_7479-536 aa

PF13833.13EF-hand_8509-541 aa

PF13405.13EF-hand_6513-539 aa

PF00036.39EF-hand_1513-540 aa

PF13202.13EF-hand_5515-537 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026787	`PF01553.27`	Acyltransferase	183	296	5e-19	69.1
LXL04_026787	`PF13499.13`	EF-hand_7	479	536	7.1e-12	46.2
LXL04_026787	`PF13833.13`	EF-hand_8	509	541	1.2e-11	44.9
LXL04_026787	`PF13405.13`	EF-hand_6	513	539	3.3e-14	51.9
LXL04_026787	`PF00036.39`	EF-hand_1	513	540	1.4e-13	50.0
LXL04_026787	`PF13202.13`	EF-hand_5	515	537	8e-07	29.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S8S2`	Arabidopsis thaliana	Lysophospholipid acyltransferase LPEAT2	63.522%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card