LXL04_026705 | RubberDandelionOmics

Gene overview

LXL04_026705

Reference: OH-1004 Chr: Chr06 Coordinates: 1653043-1655679 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1434 bp · LXL04_026705|LXL04_026705|OH1004|cDNA

ATGTCTATATACGATAAAGCATTCATGAACAGCGAGCTCTCAAAACCTACCTCTATATTCGGTCTCCGGCTATGGGTTGTCGTCGGGATCTTCGTCGGAGTTATCATAGTCCTCGTGCTTTTCCTCATCTCCGTCTGCATCACCTCCCGCCGTCGACACTCTCACTCGAGTAAAAAAAATGAACAAACCCTAACCCCTACAGTATCGAAAGAAATACAAGAGATAGTCCACCACGAGTCGACTGCAGCTGTGGATCACCG...

CDS

Download CDS FASTA

1434 bp · LXL04_026705|LXL04_026705|OH1004|CDS

ATGTCTATATACGATAAAGCATTCATGAACAGCGAGCTCTCAAAACCTACCTCTATATTCGGTCTCCGGCTATGGGTTGTCGTCGGGATCTTCGTCGGAGTTATCATAGTCCTCGTGCTTTTCCTCATCTCCGTCTGCATCACCTCCCGCCGTCGACACTCTCACTCGAGTAAAAAAAATGAACAAACCCTAACCCCTACAGTATCGAAAGAAATACAAGAGATAGTCCACCACGAGTCGACTGCAGCTGTGGATCACCG...

Protein

Download Protein FASTA

477 aa · LXL04_026705|LXL04_026705|OH1004|PROTEIN

MSIYDKAFMNSELSKPTSIFGLRLWVVVGIFVGVIIVLVLFLISVCITSRRRHSHSSKKNEQTLTPTVSKEIQEIVHHESTAAVDHRMSVPEIQIDIGKSEHRVVFSDRQSSGESRATSNDTASYCGGSGGSSLPQVSHLGWGRWYTLRELEAATNGLADENVIGEGGYGIVYSGILGDNTRVAVKNLLNNRGQAEREFKVEVEAIGRVRHKNLVRLLGYCVEGAYRMLVYEYVDNGNLDQWLHGDVGDVSPLSWSIRLN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026705`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026705

Location Chr06:1653043-1655679 (-)

Description Similar to At1g01540: Probable serine/threonine-protein kinase At1g01540

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g01540`	Probable serine/threonine-protein kinase At1g01540.	No verified direct reference in this release
`At4g34500`	Probable receptor-like serine/threonine-protein kinase At4g34500.	No verified direct reference in this release
`At2g42960`	Probable receptor-like protein kinase At2g42960.	No verified direct reference in this release
`At5g18500`	Probable receptor-like protein kinase At5g18500.	No verified direct reference in this release
`At3g17420`	Probable receptor-like protein kinase At3g17420.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026705 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0046777 protein autophosphorylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009514 glyoxysome Cellular Component

GO:0016020 membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G01540

ath:AT2G42960

ath:AT3G17420

ath:AT4G34500

ath:AT5G18500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.790

Rank 1 · LXL04_026705 · OH-1004

Cytoplasm0.156

Rank 2 · LXL04_026705 · OH-1004

Nucleus0.132

Rank 3 · LXL04_026705 · OH-1004

Endoplasmic reticulum0.048

Rank 4 · LXL04_026705 · OH-1004

Golgi apparatus0.026

Rank 5 · LXL04_026705 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714.24PK_Tyr_Ser-Thr161-428 aa

PF00069.32Pkinase161-427 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026705	`PF07714.24`	PK_Tyr_Ser-Thr	161	428	4.5e-46	158.0
LXL04_026705	`PF00069.32`	Pkinase	161	427	2.5e-45	155.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3EDL4`	Arabidopsis thaliana	Probable serine/threonine-protein kinase At1g01540	76.562%	Swiss-Prot	strong database homology
`Q6NKZ9`	Arabidopsis thaliana	Probable receptor-like serine/threonine-protein kinase At4g34500	56.916%	Swiss-Prot	strong database homology
`Q9SJG2`	Arabidopsis thaliana	Probable receptor-like protein kinase At2g42960	55.106%	Swiss-Prot	strong database homology
`Q8LEB6`	Arabidopsis thaliana	Probable receptor-like protein kinase At5g18500	54.795%	Swiss-Prot	strong database homology
`Q9LRP3`	Arabidopsis thaliana	Probable receptor-like protein kinase At3g17420	51.380%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card