LXL04_026510 | RubberDandelionOmics

Gene overview

LXL04_026510

Reference: OH-1004 Chr: Chr05 Coordinates: 127517338-127520778 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1644 bp · LXL04_026510|LXL04_026510|OH1004|cDNA

ATGACCGGAAATCACGAGGCAAGAGTCCAATGGGTGATTGGTTCCCCGTTTCTCTCCATCTTCACCGTCGTCTCAACTTTCAGATGCATCAACACCCTCCCCTCCGATCCTCTCTCCCCAGATTTCTCCAAGGAATCAGATGATATGCGAGCATTGTTACCTAGGGGATTCGAGGTAATCGGATCTCAGATTGCTGGCACCACCTATCCAAATGTGAAATCAAAAATCGATTTTGTATTGACCAAGCTTGAGATTAAGAG...

CDS

Download CDS FASTA

1644 bp · LXL04_026510|LXL04_026510|OH1004|CDS

ATGACCGGAAATCACGAGGCAAGAGTCCAATGGGTGATTGGTTCCCCGTTTCTCTCCATCTTCACCGTCGTCTCAACTTTCAGATGCATCAACACCCTCCCCTCCGATCCTCTCTCCCCAGATTTCTCCAAGGAATCAGATGATATGCGAGCATTGTTACCTAGGGGATTCGAGGTAATCGGATCTCAGATTGCTGGCACCACCTATCCAAATGTGAAATCAAAAATCGATTTTGTATTGACCAAGCTTGAGATTAAGAG...

Protein

Download Protein FASTA

547 aa · LXL04_026510|LXL04_026510|OH1004|PROTEIN

MTGNHEARVQWVIGSPFLSIFTVVSTFRCINTLPSDPLSPDFSKESDDMRALLPRGFEVIGSQIAGTTYPNVKSKIDFVLTKLEIKRRVATVVAHELAHQWFGNLVTMEWWTHLWLNEGFATWVSYLAADGLFPEWKIWTQFLDESTEGLRLDGLSESHPIEVEINHAGEIDEIFDAISYWKGASVIRMLQSYLGPQVFQRALAKYVQRHACSNAKTEDLWAQKGYPVISIKLKDNKLEFEQVQFLSSGCQGEGQWVVPI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026510`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026510

Location Chr05:127517338-127520778 (-)

Description Similar to APM1: Aminopeptidase M1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g33090`	Metallopeptidase that binds to the auxin transport inhibitor N-1-naphthylphthalamic acid (NPA).	Identification, purification, and molecular cloning of N-1-naphthylphthalmic acid-binding plasma membrane-associated aminopeptidases from Arabidopsis.2002 · DOI: 10.1104/pp.010519 Mutation of the membrane-associated M1 protease APM1 results in distinct embryonic and seedling developmental defects in Arabidopsis.2009 · DOI: 10.1105/tpc.108.059634 The catalytic and protein-protein interaction domains are required for APM1 function.2010 · DOI: 10.1104/pp.109.148742 Cytoplasm localization of aminopeptidase M1 and its functional activity in root hair cells and BY-2 cells.2012 · DOI: 10.1007/s11033-012-1896-1

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0218200`	Aminopeptidase M1-A.	No verified direct reference in this release
`Os08g0398700`	Aminopeptidase M1-B.	No verified direct reference in this release
`Os09g0362500`	Aminopeptidase M1-C.	No verified direct reference in this release
`Os09g0362800`	Aminopeptidase M1-D.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026510 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009926 auxin polar transport Biological Process

GO:0043171 peptide catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004177 aminopeptidase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0010013 N-1-naphthylphthalamic acid binding Molecular Function

GO:0016285 alanyl aminopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT4G33090

dosa:Os02g0218200

dosa:Os08g0398700

dosa:Os09g0362500

dosa:Os09g0362800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.396

Rank 1 · LXL04_026510 · OH-1004

Nucleus0.184

Rank 2 · LXL04_026510 · OH-1004

Mitochondrion0.147

Rank 3 · LXL04_026510 · OH-1004

Endoplasmic reticulum0.141

Rank 4 · LXL04_026510 · OH-1004

Peroxisome0.112

Rank 5 · LXL04_026510 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01433.27Peptidase_M182-222 aa

PF11838.15ERAP1_C268-448 aa

PF17286.8PRMT5_C472-514 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026510	`PF01433.27`	Peptidase_M1	82	222	1.3e-56	192.4
LXL04_026510	`PF11838.15`	ERAP1_C	268	448	3.8e-42	145.5
LXL04_026510	`PF17286.8`	PRMT5_C	472	514	1.9e-07	31.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZH2`	Arabidopsis thaliana	Aminopeptidase M1	63.146%	Swiss-Prot	moderate database homology
`Q6Z6L4`	Oryza sativa subsp. japonica	Aminopeptidase M1-A	56.220%	Swiss-Prot	moderate database homology
`Q0J5V5`	Oryza sativa subsp. japonica	Aminopeptidase M1-B	50.972%	Swiss-Prot	strong database homology
`Q0J2B5`	Oryza sativa subsp. japonica	Aminopeptidase M1-C	51.351%	Swiss-Prot	strong database homology
`Q6K4E7`	Oryza sativa subsp. japonica	Aminopeptidase M1-D	51.869%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card