LXL04_026364 | RubberDandelionOmics

Gene overview

LXL04_026364

Reference: OH-1004 Chr: Chr05 Coordinates: 125216458-125218903 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1056 bp · LXL04_026364|LXL04_026364|OH1004|cDNA

ATGGCGTCGGAGGATGTAGTAGGGAAGACCAGCGCTACGATCGCTAATCTCGCCGAAGAAGCTAAGATTGCCAGTGAAGGTGTCAAGGCTCCTAGCCGCCACGCTTTACTCAGCATCTGCAAGTCTCTCGTCGCCGGCGGCGTTGCCGGTGGAGTATCAAGGACTGCTGTTGCTCCTCTAGAACGACTGAAAATCCTGCTCCAGGTTCAAAACCCGCATGCCATAAAATACAATGGTACAATCCAAGGATTGAAATATAT...

CDS

Download CDS FASTA

1056 bp · LXL04_026364|LXL04_026364|OH1004|CDS

ATGGCGTCGGAGGATGTAGTAGGGAAGACCAGCGCTACGATCGCTAATCTCGCCGAAGAAGCTAAGATTGCCAGTGAAGGTGTCAAGGCTCCTAGCCGCCACGCTTTACTCAGCATCTGCAAGTCTCTCGTCGCCGGCGGCGTTGCCGGTGGAGTATCAAGGACTGCTGTTGCTCCTCTAGAACGACTGAAAATCCTGCTCCAGGTTCAAAACCCGCATGCCATAAAATACAATGGTACAATCCAAGGATTGAAATATAT...

Protein

Download Protein FASTA

351 aa · LXL04_026364|LXL04_026364|OH1004|PROTEIN

MASEDVVGKTSATIANLAEEAKIASEGVKAPSRHALLSICKSLVAGGVAGGVSRTAVAPLERLKILLQVQNPHAIKYNGTIQGLKYIWRTEGFRGLFKGNGTNCARIVPNSAVKFFSYEEASKGILYLYRQQPGNEDAELTPLLRLGAGACAGIIAMSATYPMDLVRGRLTVQTDKSPSQYRGIAHALRTVLREEGPRALYKGWLPSVIGVVPYVGLNFAVYESLKDWLVKTRPFGLVEDTELSVTTKLACGAAAGTVGQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026364`
TK1151 ID	TkA06G014630
OH-1004 ID	LXL04_026364
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026364

Location Chr05:125216458-125218903 (+)

Description Similar to ADNT1: Mitochondrial adenine nucleotide transporter ADNT1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g01100`	Mitochondrial adenylate carrier that catalyzes specifically the transport of ATP, ADP and AMP by a counter-exchange mechanism across the inner mitochondrial membrane.	Identification and characterization of ADNT1, a novel mitochondrial adenine nucleotide transporter from Arabidopsis.2008 · DOI: 10.1104/pp.108.130310
`At5g51050`	Calcium-dependent mitochondrial carrier protein that catalyzes the import of ATP co-transported with metal divalent cations across the mitochondrial inner membrane in exchange for phosphate (Pi).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026364 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009060 aerobic respiration Biological Process

GO:0015866 ADP transport Biological Process

GO:0015867 ATP transport Biological Process

GO:0035435 phosphate ion transmembrane transport Biological Process

GO:0051503 adenine nucleotide transport Biological Process

GO:0070588 calcium ion transmembrane transport Biological Process

GO:0080121 AMP transport Biological Process

GO:1902558 5'-adenylyl sulfate transmembrane transport Biological Process

GO:1902559 3'-phospho-5'-adenylyl sulfate transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

KEGG gene cross-reference

ath:AT4G01100

ath:AT5G51050

ddi:DDB_G0285599

sce:YPR011C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.929

Rank 1 · LXL04_026364 · OH-1004

Cytoplasm0.035

Rank 2 · LXL04_026364 · OH-1004

Nucleus0.025

Rank 3 · LXL04_026364 · OH-1004

Cell membrane0.023

Rank 4 · LXL04_026364 · OH-1004

Endoplasmic reticulum0.014

Rank 5 · LXL04_026364 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00153.33Mito_carr38-123 aa

PF00153.33Mito_carr140-231 aa

PF00153.33Mito_carr243-343 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026364	`PF00153.33`	Mito_carr	38	123	1.8e-82	271.9
LXL04_026364	`PF00153.33`	Mito_carr	140	231	1.8e-82	271.9
LXL04_026364	`PF00153.33`	Mito_carr	243	343	1.8e-82	271.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04619`	Arabidopsis thaliana	Mitochondrial adenine nucleotide transporter ADNT1	82.584%	Swiss-Prot	strong database homology
`Q9FI43`	Arabidopsis thaliana	Calcium-dependent mitochondrial ATP-magnesium/phosphate carrier protein 2	37.838%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card