LXL04_026343 | RubberDandelionOmics

Gene overview

LXL04_026343

Reference: OH-1004 Chr: Chr05 Coordinates: 124925840-124927931 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1293 bp · LXL04_026343|LXL04_026343|OH1004|cDNA

ATGAGGACTTCAATGGCGGATTGGTGGGAAACTTGGCCAGCAAAAACAGCAGAATCTCTCTTTTCTTTCATGAACACATTagttttcgtttttcttgattTGTTGGATATCATAATGTGCGTTTTCTTCAGATATGTTGATGAGATTTTGGAGGGAAAGTCAACCCCATGTTATTGTCGAAGTCAAGGTCGAATTAATGGCTGTGAAGATAAAGACATTGGGATTTCAGATACTCTATTTGGAAGGAAAAACGTGTTTAG...

CDS

Download CDS FASTA

1293 bp · LXL04_026343|LXL04_026343|OH1004|CDS

ATGAGGACTTCAATGGCGGATTGGTGGGAAACTTGGCCAGCAAAAACAGCAGAATCTCTCTTTTCTTTCATGAACACATTAGTTTTCGTTTTTCTTGATTTGTTGGATATCATAATGTGCGTTTTCTTCAGATATGTTGATGAGATTTTGGAGGGAAAGTCAACCCCATGTTATTGTCGAAGTCAAGGTCGAATTAATGGCTGTGAAGATAAAGACATTGGGATTTCAGATACTCTATTTGGAAGGAAAAACGTGTTTAG...

Protein

Download Protein FASTA

430 aa · LXL04_026343|LXL04_026343|OH1004|PROTEIN

MRTSMADWWETWPAKTAESLFSFMNTLVFVFLDLLDIIMCVFFRYVDEILEGKSTPCYCRSQGRINGCEDKDIGISDTLFGRKNVFREIGFTRITQPKVSLSSNNTGTDDLREIRWSDCGCESCVSWINNGDDQKLHVVVKESSEGYQDSGKNVIFLHGFLSSSFLWTETVFPELGNSKYRLFAIDLLGFGNSPKPRECLYTLNDHLEMVEKSVIQKFNLTSFHLVAHSMGCIIALALAAKHPNNLKSITLIAPPYFLSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026343`
TK1151 ID	TkAUNG022790
OH-1004 ID	LXL04_026343
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026343

Location Chr05:124925840-124927931 (-)

Description Similar to BDG4: Probable lysophospholipase BODYGUARD 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17780`	Involved in cuticle development and morphogenesis.	No verified direct reference in this release
`At5g17720`	Involved in cuticle development and morphogenesis.	No verified direct reference in this release
`At1g64670`	Controls cuticle development and morphogenesis, by promoting cutin and suberin monomers loading.	The plant cuticle is required for osmotic stress regulation of abscisic acid biosynthesis and osmotic stress tolerance in Arabidopsis.2011 · DOI: 10.1105/tpc.110.081943
`At4g24140`	Involved in cuticle development and morphogenesis.	No verified direct reference in this release
`At5g41900`	Involved in cuticle development and morphogenesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026343 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0009688 abscisic acid biosynthetic process Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0010115 regulation of abscisic acid biosynthetic process Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0010148 transpiration Biological Process

GO:0010224 response to UV-B Biological Process

GO:0010345 suberin biosynthetic process Biological Process

GO:0048527 lateral root development Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0071555 cell wall organization Biological Process

GO:1901959 positive regulation of cutin biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT1G64670

ath:AT4G24140

ath:AT5G17720

ath:AT5G17780

ath:AT5G41900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.302

Rank 1 · LXL04_026343 · OH-1004

Golgi apparatus0.206

Rank 2 · LXL04_026343 · OH-1004

Cell membrane0.153

Rank 3 · LXL04_026343 · OH-1004

Nucleus0.150

Rank 4 · LXL04_026343 · OH-1004

Cytoplasm0.116

Rank 5 · LXL04_026343 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12146.16Hydrolase_4152-404 aa

PF00561.27Abhydrolase_1153-405 aa

PF12697.14Abhydrolase_6154-415 aa

PF10230.16LIDHydrolase177-403 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026343	`PF12146.16`	Hydrolase_4	152	404	6.1e-17	62.5
LXL04_026343	`PF00561.27`	Abhydrolase_1	153	405	6.9e-30	105.2
LXL04_026343	`PF12697.14`	Abhydrolase_6	154	415	4.7e-18	67.3
LXL04_026343	`PF10230.16`	LIDHydrolase	177	403	7.5e-07	29.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q700D5`	Arabidopsis thaliana	Probable lysophospholipase BODYGUARD 4	51.667%	Swiss-Prot	strong database homology
`Q9FN79`	Arabidopsis thaliana	Probable lysophospholipase BODYGUARD 5	47.981%	Swiss-Prot	moderate database homology
`Q8LFX7`	Arabidopsis thaliana	Probable lysophospholipase BODYGUARD 1	39.565%	Swiss-Prot	moderate database homology
`O22977`	Arabidopsis thaliana	Probable lysophospholipase BODYGUARD 3	37.764%	Swiss-Prot	moderate database homology
`Q9FJ24`	Arabidopsis thaliana	Probable lysophospholipase BODYGUARD 2	37.555%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card