LXL04_026292 | RubberDandelionOmics

Gene overview

LXL04_026292

Reference: OH-1004 Chr: Chr05 Coordinates: 124485425-124487766 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1815 bp · LXL04_026292|LXL04_026292|OH1004|cDNA

ATGCCTGGTTTAGTTTCAGTGAAGACGCCGCCCAGAATCACCATACCTGAGGATAGCCAGAACCAGAGTAACCAGATCCGGCCGACTCCTGAACGTTCTGACTCGGTTAACACCAAAAATACCCCACCGGCACAACGGAGACCTCCGTCGCCGTCTCCTTCGTCCTCACGCGCGAAGCCGTCGCCAGATCGGGGATCTGGAAAGAAgaaatcgccggaaaaacactCTTTACTTGATGAGTCGTCGCTGGACAACCCCGA...

CDS

Download CDS FASTA

1815 bp · LXL04_026292|LXL04_026292|OH1004|CDS

ATGCCTGGTTTAGTTTCAGTGAAGACGCCGCCCAGAATCACCATACCTGAGGATAGCCAGAACCAGAGTAACCAGATCCGGCCGACTCCTGAACGTTCTGACTCGGTTAACACCAAAAATACCCCACCGGCACAACGGAGACCTCCGTCGCCGTCTCCTTCGTCCTCACGCGCGAAGCCGTCGCCAGATCGGGGATCTGGAAAGAAGAAATCGCCGGAAAAACACTCTTTACTTGATGAGTCGTCGCTGGACAACCCCGA...

Protein

Download Protein FASTA

604 aa · LXL04_026292|LXL04_026292|OH1004|PROTEIN

MPGLVSVKTPPRITIPEDSQNQSNQIRPTPERSDSVNTKNTPPAQRRPPSPSPSSSRAKPSPDRGSGKKKSPEKHSLLDESSLDNPDLGPFLLKLARDTIASGDGPGKALDYALRASKSFERCAVEGEPSLDLAMCLHVVAAIYCSLGRFEEAIPVLDRAIKVPEVSRGADHALAAFSGYMQLGDTHSMLGQLDRSIECYKEGLKIQMEALGDTDPRVAETCRYLAEAHVQAMQFDEADTLCKRTLEIHRVHSPPASLEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026292`
TK1151 ID	TkA06G016070
OH-1004 ID	LXL04_026292
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 97.531 / OH-1004 65.397 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026292

Location Chr05:124485425-124487766 (+)

Description Similar to KLCR1: Protein KINESIN LIGHT CHAIN-RELATED 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g10840`	Protein KINESIN LIGHT CHAIN-RELATED 1.	No verified direct reference in this release
`At3g27960`	Protein KINESIN LIGHT CHAIN-RELATED 2.	No verified direct reference in this release
`At1g27500`	Protein KINESIN LIGHT CHAIN-RELATED 3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026292 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007368 determination of left/right symmetry Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0016055 Wnt signaling pathway Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0045494 photoreceptor cell maintenance Biological Process

GO:0060271 cilium assembly Biological Process

GO:0060287 epithelial cilium movement involved in determination of left/right asymmetry Biological Process

GO:0090090 negative regulation of canonical Wnt signaling pathway Biological Process

GO:2000095 regulation of Wnt signaling pathway, planar cell polarity pathway Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G27500

ath:AT3G27960

ath:AT4G10840

hsa:27031

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.574

Rank 1 · LXL04_026292 · OH-1004

Nucleus0.274

Rank 2 · LXL04_026292 · OH-1004

Cell membrane0.177

Rank 3 · LXL04_026292 · OH-1004

Golgi apparatus0.084

Rank 4 · LXL04_026292 · OH-1004

Lysosome / Vacuole0.066

Rank 5 · LXL04_026292 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24885.2TPR_NPHP3114-252 aa

PF13424.13TPR_12118-163 aa

PF13424.13TPR_12137-207 aa

PF17874.8TPR_MalT139-289 aa

PF13424.13TPR_12180-249 aa

PF13424.13TPR_12224-284 aa

PF14938.13SNAP257-362 aa

PF24885.2TPR_NPHP3296-425 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026292	`PF24885.2`	TPR_NPHP3	114	252	5e-23	82.4
LXL04_026292	`PF13424.13`	TPR_12	118	163	2e-58	195.2
LXL04_026292	`PF13424.13`	TPR_12	137	207	2e-58	195.2
LXL04_026292	`PF17874.8`	TPR_MalT	139	289	1e-22	81.6
LXL04_026292	`PF13424.13`	TPR_12	180	249	2e-58	195.2
LXL04_026292	`PF13424.13`	TPR_12	224	284	2e-58	195.2
LXL04_026292	`PF14938.13`	SNAP	257	362	8.5e-10	39.3
LXL04_026292	`PF24885.2`	TPR_NPHP3	296	425	5e-23	82.4
LXL04_026292	`PF13424.13`	TPR_12	300	374	2e-58	195.2
LXL04_026292	`PF17874.8`	TPR_MalT	301	453	1e-22	81.6
LXL04_026292	`PF13424.13`	TPR_12	342	417	2e-58	195.2
LXL04_026292	`PF13424.13`	TPR_12	471	543	2e-58	195.2
LXL04_026292	`PF13374.13`	TPR_10	510	551	3.4e-41	138.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81629`	Arabidopsis thaliana	Protein KINESIN LIGHT CHAIN-RELATED 1	74.038%	Swiss-Prot	strong database homology
`Q9LII8`	Arabidopsis thaliana	Protein KINESIN LIGHT CHAIN-RELATED 2	58.135%	Swiss-Prot	strong database homology
`F4HSX9`	Arabidopsis thaliana	Protein KINESIN LIGHT CHAIN-RELATED 3	60.870%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card