LXL04_026030 | RubberDandelionOmics

Gene overview

LXL04_026030

Reference: OH-1004 Chr: Chr05 Coordinates: 119927049-119929602 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

933 bp · LXL04_026030|LXL04_026030|OH1004|cDNA

atggatgtgattaagtcacAGCAGTTATCAGCTCGGCCGATCGAGAAGGTGGTCGTACACCCTTTAGTACTCCTTAGCATCGTCGACAACTACTATAGAGTAGCCAAAGACACTCGCAAACGTGTCGTTGGTGTTCTCCTCGGCAGTTCCTTCAAAGGCACCGTCGACGTTACAAACAGCTATGCAGTGCCTTTTGAGGAAGACGAAAAGGATCCCAGCATTTGGTTTCTTGATCACAACTATCACGAGGCCATGTTCTC...

CDS

Download CDS FASTA

933 bp · LXL04_026030|LXL04_026030|OH1004|CDS

ATGGATGTGATTAAGTCACAGCAGTTATCAGCTCGGCCGATCGAGAAGGTGGTCGTACACCCTTTAGTACTCCTTAGCATCGTCGACAACTACTATAGAGTAGCCAAAGACACTCGCAAACGTGTCGTTGGTGTTCTCCTCGGCAGTTCCTTCAAAGGCACCGTCGACGTTACAAACAGCTATGCAGTGCCTTTTGAGGAAGACGAAAAGGATCCCAGCATTTGGTTTCTTGATCACAACTATCACGAGGCCATGTTCTC...

Protein

Download Protein FASTA

310 aa · LXL04_026030|LXL04_026030|OH1004|PROTEIN

MDVIKSQQLSARPIEKVVVHPLVLLSIVDNYYRVAKDTRKRVVGVLLGSSFKGTVDVTNSYAVPFEEDEKDPSIWFLDHNYHEAMFSMFKRINAKEHVVGWYSTGPKLRENDLDVHGLFNDYVPNPVLVIIDVQPKELGIPTKAYYAIEEVKENATQKSQKVFVHVPSEIAAHEVEEIGVEHLLRDVKDTTISTLATEVTGKLAALKGLDARLKEIRGYLDLVIDGKLPLNHEILYHLQDVFNLLPNLNVADLIKAFAVK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026030`
TK1151 ID	TkA06G031000
OH-1004 ID	LXL04_026030
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	97.500
Protein coverage (%)	TK1151 97.143 / OH-1004 65.806 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026030

Location Chr05:119927049-119929602 (-)

Description Similar to RPN8A: 26S proteasome non-ATPase regulatory subunit 7 homolog A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g05780`	Acts as a regulatory subunit of the 26S proteasome which is involved in the ATP-dependent degradation of ubiquitinated proteins (By similarity).	RPN1a, a 26S proteasome subunit, is required for innate immunity in Arabidopsis.2012 · DOI: 10.1111/j.1365-313x.2012.05048.x
`At3g11270`	Acts as a regulatory subunit of the 26S proteasome which is involved in the ATP-dependent degradation of ubiquitinated proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026030 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006364 rRNA processing Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009965 leaf morphogenesis Biological Process

GO:0030163 protein catabolic process Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0045087 innate immune response Biological Process

GO:0048731 system development Biological Process

GO:0000502 proteasome complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005838 proteasome regulatory particle Cellular Component

KEGG gene cross-reference

ath:AT3G11270

ath:AT5G05780

bta:512456

ddi:DDB_G0279633

mmu:17463

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.575

Rank 1 · LXL04_026030 · OH-1004

Nucleus0.538

Rank 2 · LXL04_026030 · OH-1004

Endoplasmic reticulum0.033

Rank 3 · LXL04_026030 · OH-1004

Lysosome / Vacuole0.031

Rank 4 · LXL04_026030 · OH-1004

Mitochondrion0.028

Rank 5 · LXL04_026030 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01398.27JAB14-125 aa

PF13012.12MitMem_reg174-285 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026030	`PF01398.27`	JAB	14	125	4.1e-35	120.8
LXL04_026030	`PF13012.12`	MitMem_reg	174	285	5.2e-40	136.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O24412`	Arabidopsis thaliana	26S proteasome non-ATPase regulatory subunit 7 homolog A	88.636%	Swiss-Prot	strong database homology
`Q9C774`	Arabidopsis thaliana	26S proteasome non-ATPase regulatory subunit 7 homolog B	87.742%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card