LXL04_026010 | RubberDandelionOmics

Gene overview

LXL04_026010

Reference: OH-1004 Chr: Chr05 Coordinates: 119726435-119730802 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2913 bp · LXL04_026010|LXL04_026010|OH1004|cDNA

ATGGCTACAGCGATGATACGAAGGACGGCCACCTCCGCCACCGTCAGACTCACCCGATACGCTCTACTCACCGCCACTGATGCCTCTTCGTGCGTCTCTCGCTCTCAGTCTCGCTTATACTCCTCCATTGTTACTACACCAGAGATTTCTGCGGTCCGTATACCTTACTTTCTTCACAACGGTTCTATCGGACACAACatgatttcttcatcactttctcGCCCTTATTCAACTGCTGCCAATCCTTCCCAGTTCAACAA...

CDS

Download CDS FASTA

2913 bp · LXL04_026010|LXL04_026010|OH1004|CDS

ATGGCTACAGCGATGATACGAAGGACGGCCACCTCCGCCACCGTCAGACTCACCCGATACGCTCTACTCACCGCCACTGATGCCTCTTCGTGCGTCTCTCGCTCTCAGTCTCGCTTATACTCCTCCATTGTTACTACACCAGAGATTTCTGCGGTCCGTATACCTTACTTTCTTCACAACGGTTCTATCGGACACAACATGATTTCTTCATCACTTTCTCGCCCTTATTCAACTGCTGCCAATCCTTCCCAGTTCAACAA...

Protein

Download Protein FASTA

970 aa · LXL04_026010|LXL04_026010|OH1004|PROTEIN

MATAMIRRTATSATVRLTRYALLTATDASSCVSRSQSRLYSSIVTTPEISAVRIPYFLHNGSIGHNMISSSLSRPYSTAANPSQFNNKDYTEMAWEGIVGAVDAARGSKQQIVESEHLMKALLEQKDGLARRILTKAGLDNTSVLQATDSFIAQQPKVMDTSSPVLGSNLSSLLENARKFKKEMGDDFVSVEHLVLAFPSDKRFGKQLFTNLQLSEKSLKEAVQAVRGSQKVTDQNPEGKYEALDKYGNDLTELARRGKL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026010`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026010

Location Chr05:119726435-119730802 (-)

Description Similar to CLPB4: Chaperone protein ClpB4, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g25140`	Molecular chaperone that does not seem to be involved in heat stress response or tolerance.	The Arabidopsis ClpB/Hsp100 family of proteins: chaperones for stress and chloroplast development.2007 · DOI: 10.1111/j.1365-313x.2006.02940.x
`At5g15450`	Molecular chaperone essential for chloroplast development and seedling viability.	An Arabidopsis chloroplast-targeted Hsp101 homologue, APG6, has an essential role in chloroplast development as well as heat-stress response.2006 · DOI: 10.1111/j.1365-313x.2006.02873.x The Arabidopsis ClpB/Hsp100 family of proteins: chaperones for stress and chloroplast development.2007 · DOI: 10.1111/j.1365-313x.2006.02940.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0181900`	Molecular chaperone that may not be involved in heat stress response or tolerance.	No verified direct reference in this release
`Os03g0426900`	Molecular chaperone that may play a role in chloroplast development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026010 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009408 response to heat Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0042026 protein refolding Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009532 plastid stroma Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ana:alr5084

ath:AT2G25140

ath:AT5G15450

dosa:Os02g0181900

dosa:Os03g0426900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.856

Rank 1 · LXL04_026010 · OH-1004

Plastid0.117

Rank 2 · LXL04_026010 · OH-1004

Cytoplasm0.076

Rank 3 · LXL04_026010 · OH-1004

Nucleus0.053

Rank 4 · LXL04_026010 · OH-1004

Cell membrane0.024

Rank 5 · LXL04_026010 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02861.26Clp_N90-208 aa

PF13191.13AAA_16263-309 aa

PF23569.2NBD_SMAX1268-367 aa

PF13401.13AAA_22280-366 aa

PF00004.36AAA287-419 aa

PF17871.8AAA_lid_9425-527 aa

PF07724.21AAA_2683-852 aa

PF00158.33Sigma54_activat686-804 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026010	`PF02861.26`	Clp_N	90	208	5.1e-30	105.0
LXL04_026010	`PF13191.13`	AAA_16	263	309	2.8e-10	41.7
LXL04_026010	`PF23569.2`	NBD_SMAX1	268	367	3e-08	34.5
LXL04_026010	`PF13401.13`	AAA_22	280	366	2.4e-12	48.0
LXL04_026010	`PF00004.36`	AAA	287	419	9.3e-27	94.8
LXL04_026010	`PF17871.8`	AAA_lid_9	425	527	4.1e-33	114.1
LXL04_026010	`PF07724.21`	AAA_2	683	852	4.9e-72	242.1
LXL04_026010	`PF00158.33`	Sigma54_activat	686	804	5.4e-10	39.9
LXL04_026010	`PF07728.21`	AAA_5	688	809	3.9e-17	63.3
LXL04_026010	`PF00004.36`	AAA	689	807	9.3e-27	94.8
LXL04_026010	`PF13401.13`	AAA_22	689	783	2.4e-12	48.0
LXL04_026010	`PF10431.16`	ClpB_D2-small	859	938	2.6e-24	85.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYJ7`	Arabidopsis thaliana	Chaperone protein ClpB4, mitochondrial	77.373%	Swiss-Prot	strong database homology
`Q9LF37`	Arabidopsis thaliana	Chaperone protein ClpB3, chloroplastic	71.381%	Swiss-Prot	strong database homology
`Q0E3C8`	Oryza sativa subsp. japonica	Chaperone protein ClpB3, mitochondrial	79.219%	Swiss-Prot	strong database homology
`Q75GT3`	Oryza sativa subsp. japonica	Chaperone protein ClpB2, chloroplastic	72.350%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card