LXL04_025954 | RubberDandelionOmics

Gene overview

LXL04_025954

Reference: OH-1004 Chr: Chr05 Coordinates: 118956558-118959887 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1872 bp · LXL04_025954|LXL04_025954|OH1004|cDNA

ATGGATGTGGATCCTGATGACGTTTTCCGAGACGATGAAGACGATCCCGAAAATGAATTCTATCAGGAAAGGCAATCGAGCAAGGAACTCGTGGTATTCTTGGTGGATGCTTCTCCGAAAATGTTCAGCATCACTTGTCCTGGGGAAGATGAAGAGAACACGTCTCATTTTCATGTTGCTGTGAGCTCTGTTTTGGGGTCTATCAAGGTTCAAATCATCAATAGGCCATATGATGAAGTTGCAATATGCTTCTTCAATAC...

CDS

Download CDS FASTA

1872 bp · LXL04_025954|LXL04_025954|OH1004|CDS

ATGGATGTGGATCCTGATGACGTTTTCCGAGACGATGAAGACGATCCCGAAAATGAATTCTATCAGGAAAGGCAATCGAGCAAGGAACTCGTGGTATTCTTGGTGGATGCTTCTCCGAAAATGTTCAGCATCACTTGTCCTGGGGAAGATGAAGAGAACACGTCTCATTTTCATGTTGCTGTGAGCTCTGTTTTGGGGTCTATCAAGGTTCAAATCATCAATAGGCCATATGATGAAGTTGCAATATGCTTCTTCAATAC...

Protein

Download Protein FASTA

623 aa · LXL04_025954|LXL04_025954|OH1004|PROTEIN

MDVDPDDVFRDDEDDPENEFYQERQSSKELVVFLVDASPKMFSITCPGEDEENTSHFHVAVSSVLGSIKVQIINRPYDEVAICFFNTREKKNLQDLSGVYVFNVPEREQLDSLTARFIKEFDQVKESFSKVIGSEFGIVPGSRDNSLYNALWVAQALLRKGSAKTADKRILLLTNEDDPFGNIKGVTKLDMARTTLQRAKDAQDLGISIELLPLSTPNEEFNVSLFYADLIGLEGDDLAQFMPLAGERFEDLNKQLRKRM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025954`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025954

Location Chr05:118956558-118959887 (-)

Description Similar to KU70: ATP-dependent DNA helicase 2 subunit KU70

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g16970`	Single-stranded DNA-dependent ATP-dependent helicase.	Telomere length deregulation and enhanced sensitivity to genotoxic stress in Arabidopsis mutants deficient in Ku70.2002 · DOI: 10.1093/emboj/21.11.2819 Identification of Ku70 and Ku80 homologues in Arabidopsis thaliana: evidence for a role in the repair of DNA double-strand breaks.2002 · DOI: 10.1046/j.1365-313x.2002.01258.x Disruption of the Arabidopsis AtKu80 gene demonstrates an essential role for AtKu80 protein in efficient repair of DNA double-strand breaks in vivo.2002 · DOI: 10.1046/j.1365-313x.2002.01370.x Ku is required for telomeric C-rich strand maintenance but not for end-to-end chromosome fusions in Arabidopsis.2003 · DOI: 10.1073/pnas.0236128100

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0184900`	Single-stranded DNA-dependent ATP-dependent helicase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025954 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0000725 recombinational repair Biological Process

GO:0002218 activation of innate immune response Biological Process

GO:0006281 DNA repair Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006303 double-strand break repair via nonhomologous end joining Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006974 DNA damage response Biological Process

GO:0009408 response to heat Biological Process

GO:0010212 response to ionizing radiation Biological Process

GO:0045087 innate immune response Biological Process

KEGG gene cross-reference

ath:AT1G16970

dosa:Os07g0184900

gga:395767

hsa:2547

mmu:14375

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.934

Rank 1 · LXL04_025954 · OH-1004

Cytoplasm0.184

Rank 2 · LXL04_025954 · OH-1004

Mitochondrion0.023

Rank 3 · LXL04_025954 · OH-1004

Cell membrane0.017

Rank 4 · LXL04_025954 · OH-1004

Endoplasmic reticulum0.011

Rank 5 · LXL04_025954 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03731.22Ku_N31-265 aa

PF02735.23Ku275-454 aa

PF03730.20Ku_C485-571 aa

PF02037.34SAP587-621 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025954	`PF03731.22`	Ku_N	31	265	4.9e-51	174.3
LXL04_025954	`PF02735.23`	Ku	275	454	3.4e-36	125.6
LXL04_025954	`PF03730.20`	Ku_C	485	571	2.8e-19	70.2
LXL04_025954	`PF02037.34`	SAP	587	621	1.2e-07	31.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FQ08`	Arabidopsis thaliana	ATP-dependent DNA helicase 2 subunit KU70	64.744%	Swiss-Prot	strong database homology
`Q7F1M0`	Oryza sativa subsp. japonica	ATP-dependent DNA helicase 2 subunit KU70	62.520%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card