LXL04_025919 | RubberDandelionOmics

Gene overview

LXL04_025919

Reference: OH-1004 Chr: Chr05 Coordinates: 118566542-118568356 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1359 bp · LXL04_025919|LXL04_025919|OH1004|cDNA

ATGTCCGGAAACTGGTTGCTGCCGGCGGAAACCACCAGTAGCGGTCGCCCGGTTCTTCAGCCTGCTGAGGTCGAATCCTCCCTACAACCCTCCGTCGACCTAGTCAATGAAGAGAACCCTAATTTGCCAATTTTCAAGTCCGGTCTTCTCATTCTGACAACCTACCGTCTCCTCTGGCTTCCCAACCCTGAATCTACTACATCCGCTCCGACATCAACAGCGGTGGCAGTTCCTCTTGCTGCGATCACTCACATATTTCA...

CDS

Download CDS FASTA

1359 bp · LXL04_025919|LXL04_025919|OH1004|CDS

ATGTCCGGAAACTGGTTGCTGCCGGCGGAAACCACCAGTAGCGGTCGCCCGGTTCTTCAGCCTGCTGAGGTCGAATCCTCCCTACAACCCTCCGTCGACCTAGTCAATGAAGAGAACCCTAATTTGCCAATTTTCAAGTCCGGTCTTCTCATTCTGACAACCTACCGTCTCCTCTGGCTTCCCAACCCTGAATCTACTACATCCGCTCCGACATCAACAGCGGTGGCAGTTCCTCTTGCTGCGATCACTCACATATTTCA...

Protein

Download Protein FASTA

452 aa · LXL04_025919|LXL04_025919|OH1004|PROTEIN

MSGNWLLPAETTSSGRPVLQPAEVESSLQPSVDLVNEENPNLPIFKSGLLILTTYRLLWLPNPESTTSAPTSTAVAVPLAAITHIFQSKKSIKGMFASPRVRFQVSVTPDGKVQERGSKSIVITLVFRGKSDPDSFVVKLNEAWRGRAWVGAVSASGAGQSSTPAVLGDSGGSSSSNTGLALKMPVVGVSGILRKEQEMWESTDKSLQDAFQDLNALMTKAKDMVILAEKMRQKLLSSSNSQSNSTNDEETASKEEMQEW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025919`
TK1151 ID	TkA06G035990
OH-1004 ID	LXL04_025919
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025919

Location Chr05:118566542-118568356 (-)

Description Similar to VPS36: Vacuolar protein sorting-associated protein 36

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g04920`	Component of the ESCRT-II complex (endosomal sorting complex required for transport II), which is required for multivesicular body (MVB) formation and sorting of endosomal cargo proteins into MVBs.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025919 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0007033 vacuole organization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016197 endosomal transport Biological Process

GO:0043328 protein transport to vacuole involved in ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway Biological Process

GO:0071985 multivesicular body sorting pathway Biological Process

GO:0090351 seedling development Biological Process

GO:0000814 ESCRT II complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005764 lysosome Cellular Component

GO:0005768 endosome Cellular Component

GO:0005769 early endosome Cellular Component

KEGG gene cross-reference

ath:AT5G04920

bta:511223

mmu:70160

xla:446727

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.640

Rank 1 · LXL04_025919 · OH-1004

Nucleus0.240

Rank 2 · LXL04_025919 · OH-1004

Golgi apparatus0.240

Rank 3 · LXL04_025919 · OH-1004

Lysosome / Vacuole0.084

Rank 4 · LXL04_025919 · OH-1004

Endoplasmic reticulum0.072

Rank 5 · LXL04_025919 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11605.15Vps36_ESCRT-II10-105 aa

PF04157.23EAP30187-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025919	`PF11605.15`	Vps36_ESCRT-II	10	105	6.7e-10	39.7
LXL04_025919	`PF04157.23`	EAP30	187	411	3.8e-59	200.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FF81`	Arabidopsis thaliana	Vacuolar protein sorting-associated protein 36	61.364%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card