LXL04_025801 | RubberDandelionOmics

Gene overview

LXL04_025801

Reference: OH-1004 Chr: Chr05 Coordinates: 117021980-117024167 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2109 bp · LXL04_025801|LXL04_025801|OH1004|cDNA

ATGTTGAGGGAAGACGACAAATCACAGCCGCCGCCTCTACCTGCAGCTACCGGAGGAGGAAAAATATACTCCAGGTCAGTTTCCTGGGCCGGCAAGGCAAGGGCATGTCTGCCGCCGTTACAGCCTCTCTCGGTTTCTCGGCCGAAGGCCGAGGAGTGGCCAAGGGCGGGCTCCGACGATCTCGGAGTTTGGCCGAATGTCACCGCTACTACTCCCGGCGCTAGACCTAGACCTCCTTCTCTACCTCTTAACTTAGGGAA...

CDS

Download CDS FASTA

2109 bp · LXL04_025801|LXL04_025801|OH1004|CDS

ATGTTGAGGGAAGACGACAAATCACAGCCGCCGCCTCTACCTGCAGCTACCGGAGGAGGAAAAATATACTCCAGGTCAGTTTCCTGGGCCGGCAAGGCAAGGGCATGTCTGCCGCCGTTACAGCCTCTCTCGGTTTCTCGGCCGAAGGCCGAGGAGTGGCCAAGGGCGGGCTCCGACGATCTCGGAGTTTGGCCGAATGTCACCGCTACTACTCCCGGCGCTAGACCTAGACCTCCTTCTCTACCTCTTAACTTAGGGAA...

Protein

Download Protein FASTA

702 aa · LXL04_025801|LXL04_025801|OH1004|PROTEIN

MLREDDKSQPPPLPAATGGGKIYSRSVSWAGKARACLPPLQPLSVSRPKAEEWPRAGSDDLGVWPNVTATTPGARPRPPSLPLNLGKPPREFEFKKDKLAFFDKECSRIIDHVFLGSDAVAKNRDVLRQNGITHVLNCVGFVCPEYFNTDLVYKTLWLQDSPSEDITSILYDVFDYFEDVREQNGRVFVHCCQGVSRSTSLVIAYLMWREGHSFEDAFQQVKAARGVTNPNMGFASQLLQCQKRVHAVPVSPSSVLRMYR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025801`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025801

Location Chr05:117021980-117024167 (+)

Description Similar to MKP1: Protein-tyrosine-phosphatase MKP1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55270`	Protein-tyrosine-phosphatase that acts as a negative regulator of MPK6 and MPK3 signaling by dephosphorylating and repressing MPK6 and MPK3.	Mitogen-activated protein kinase phosphatase is required for genotoxic stress relief in Arabidopsis.2001 · DOI: 10.1101/gad.192601 Distinct regulation of salinity and genotoxic stress responses by Arabidopsis MAP kinase phosphatase 1.2002 · DOI: 10.1093/emboj/cdf646 The role of NADPH oxidase and MAP kinase phosphatase in UV-B-dependent gene expression in Arabidopsis.2006 · DOI: 10.1111/j.1365-3040.2006.01555.x MAP kinase phosphatase1 and protein tyrosine phosphatase1 are repressors of salicylic acid synthesis and SNC1-mediated responses in Arabidopsis.2009 · DOI: 10.1105/tpc.109.067678 Arabidopsis MAP Kinase Phosphatase 1 (AtMKP1) negatively regulates MPK6-mediated PAMP responses and resistance against bacteria.2011 · DOI: 10.1111/j.1365-313x.2011.04588.x Arabidopsis MAP kinase phosphatase 1 is phosphorylated and activated by its substrate AtMPK6.2011 · DOI: 10.1007/s00299-011-1064-4 Arabidopsis MAP kinase phosphatase 1 and its target MAP kinases 3 and 6 antagonistically determine UV-B stress tolerance, independent of the UVR8 photoreceptor pathway.2011 · DOI: 10.1111/j.1365-313x.2011.04725.x
`At3g06110`	Has a dual specificity toward Ser/Thr and Tyr-containing proteins.	Arabidopsis MAPK phosphatase 2 (MKP2) positively regulates oxidative stress tolerance and inactivates the MPK3 and MPK6 MAPKs.2007 · DOI: 10.1074/jbc.m701888200 MAPK phosphatase MKP2 mediates disease responses in Arabidopsis and functionally interacts with MPK3 and MPK6.2010 · DOI: 10.1111/j.1365-313x.2010.04297.x Regulation of MAPK signaling and cell death by MAPK phosphatase MKP2.2010 · DOI: 10.4161/psb.5.11.13645

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025801 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006470 protein dephosphorylation Biological Process

GO:0006952 defense response Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009651 response to salt stress Biological Process

GO:0010193 response to ozone Biological Process

GO:0010224 response to UV-B Biological Process

GO:0010225 response to UV-C Biological Process

GO:0016311 dephosphorylation Biological Process

GO:0034051 negative regulation of plant-type hypersensitive response Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0070373 negative regulation of ERK1 and ERK2 cascade Biological Process

KEGG gene cross-reference

ath:AT3G06110

ath:AT3G55270

gga:395642

hsa:1846

rno:60587

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.589

Rank 1 · LXL04_025801 · OH-1004

Nucleus0.298

Rank 2 · LXL04_025801 · OH-1004

Cell membrane0.183

Rank 3 · LXL04_025801 · OH-1004

Golgi apparatus0.090

Rank 4 · LXL04_025801 · OH-1004

Endoplasmic reticulum0.066

Rank 5 · LXL04_025801 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00782.26DSPc113-243 aa

PF25466.1MPK1_gelsolin_C603-690 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025801	`PF00782.26`	DSPc	113	243	1.7e-27	96.6
LXL04_025801	`PF25466.1`	MPK1_gelsolin_C	603	690	1.9e-15	57.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C5S1`	Arabidopsis thaliana	Protein-tyrosine-phosphatase MKP1	58.883%	Swiss-Prot	moderate database homology
`Q9M8K7`	Arabidopsis thaliana	Dual specificity protein phosphatase 1B	36.129%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card