LXL04_025797 | RubberDandelionOmics

Gene overview

LXL04_025797

Reference: OH-1004 Chr: Chr05 Coordinates: 117001189-117005106 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2247 bp · LXL04_025797|LXL04_025797|OH1004|cDNA

ATGGCTACAGATTTGATTATAGGCCAAGAAGATTATAAATGCATTCTACAACTCAAGCTTAAAAGGGCAATACTGTTTGAAGATTTCAATTCAGTCAAAGCATCCGTCCATCTCCTGCTTCGATTGAGGGGTAATCTTCTTTCTGCTTTTTCCAATGTCTCCCCATATTTAGAGCTAAGTTCATGTGAGTTGATCCAAGTTTCAACCATGGAGTTAACTGGAAATGACAGTTTCACCCCTCAATCTTCATCCACCGAACT...

CDS

Download CDS FASTA

2247 bp · LXL04_025797|LXL04_025797|OH1004|CDS

ATGGCTACAGATTTGATTATAGGCCAAGAAGATTATAAATGCATTCTACAACTCAAGCTTAAAAGGGCAATACTGTTTGAAGATTTCAATTCAGTCAAAGCATCCGTCCATCTCCTGCTTCGATTGAGGGGTAATCTTCTTTCTGCTTTTTCCAATGTCTCCCCATATTTAGAGCTAAGTTCATGTGAGTTGATCCAAGTTTCAACCATGGAGTTAACTGGAAATGACAGTTTCACCCCTCAATCTTCATCCACCGAACT...

Protein

Download Protein FASTA

748 aa · LXL04_025797|LXL04_025797|OH1004|PROTEIN

MATDLIIGQEDYKCILQLKLKRAILFEDFNSVKASVHLLLRLRGNLLSAFSNVSPYLELSSCELIQVSTMELTGNDSFTPQSSSTELSLEQEFIINKTLLTHEANRHIVDCKILLQAMENVMFYASNSTNAIDACILDGIEHFASKETLDHAIYKISRAILCQCHETADMHTRTLILLEMLGNYRWDAKVVLILTAFAISYGEFRLILDVCAHSSLAASIATLKNLYWRNFEALRPQLKAMEMLIKEMVELAKWVVRFEN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025797`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025797

Location Chr05:117001189-117005106 (-)

Description Similar to SEOC: Protein SIEVE ELEMENT OCCLUSION C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67790`	Protein SIEVE ELEMENT OCCLUSION C.	No verified direct reference in this release
`At3g01670`	Scaffold protein required to form the phloem filament matrix in sieve elements.	Arabidopsis P-protein filament formation requires both AtSEOR1 and AtSEOR2.2012 · DOI: 10.1093/pcp/pcs046
`At3g01680`	Scaffold protein required to form the phloem filament matrix in sieve elements.	Arabidopsis P-protein filament formation requires both AtSEOR1 and AtSEOR2.2012 · DOI: 10.1093/pcp/pcs046

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025797 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010088 phloem development Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0097218 sieve plate Cellular Component

GO:0042803 protein homodimerization activity Molecular Function

KEGG gene cross-reference

ath:AT1G67790

ath:AT3G01670

ath:AT3G01680

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.452

Rank 1 · LXL04_025797 · OH-1004

Nucleus0.315

Rank 2 · LXL04_025797 · OH-1004

Cell membrane0.292

Rank 3 · LXL04_025797 · OH-1004

Endoplasmic reticulum0.080

Rank 4 · LXL04_025797 · OH-1004

Lysosome / Vacuole0.073

Rank 5 · LXL04_025797 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14576.12SEO_N91-347 aa

PF14577.12SEO_C514-745 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025797	`PF14576.12`	SEO_N	91	347	1e-47	163.4
LXL04_025797	`PF14577.12`	SEO_C	514	745	3.7e-52	177.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FXE2`	Arabidopsis thaliana	Protein SIEVE ELEMENT OCCLUSION C	35.714%	Swiss-Prot	moderate database homology
`Q93XX2`	Arabidopsis thaliana	Protein SIEVE ELEMENT OCCLUSION A	26.062%	Swiss-Prot	weak database homology
`Q9SS87`	Arabidopsis thaliana	Protein SIEVE ELEMENT OCCLUSION B	25.412%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card