LXL04_025785 | RubberDandelionOmics

Gene overview

LXL04_025785

Reference: OH-1004 Chr: Chr05 Coordinates: 116878455-116882493 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2871 bp · LXL04_025785|LXL04_025785|OH1004|cDNA

ATGGGTTTAGTTCTTCAATTTGTCTTACTCTTCCTCACCTGCTTAATCCCTTCCCTTCTCTGTCAAGTTACAGAATTTGTGAGTATCGATTGTGGAGGAACAAGTAATCACACCGACGTTGATACTGGTCTAGTATGGGTTTCGGATTCTGGAATCGTTCACCATGGAACATCAATTGAGCTCGAAAACCCCAACGGGAACTCAGTTCAGTATCAAAGGCGCAGAGATTTCCCCATAGACAACAAAAAGTATTGTTATAC...

CDS

Download CDS FASTA

2871 bp · LXL04_025785|LXL04_025785|OH1004|CDS

ATGGGTTTAGTTCTTCAATTTGTCTTACTCTTCCTCACCTGCTTAATCCCTTCCCTTCTCTGTCAAGTTACAGAATTTGTGAGTATCGATTGTGGAGGAACAAGTAATCACACCGACGTTGATACTGGTCTAGTATGGGTTTCGGATTCTGGAATCGTTCACCATGGAACATCAATTGAGCTCGAAAACCCCAACGGGAACTCAGTTCAGTATCAAAGGCGCAGAGATTTCCCCATAGACAACAAAAAGTATTGTTATAC...

Protein

Download Protein FASTA

956 aa · LXL04_025785|LXL04_025785|OH1004|PROTEIN

MGLVLQFVLLFLTCLIPSLLCQVTEFVSIDCGGTSNHTDVDTGLVWVSDSGIVHHGTSIELENPNGNSVQYQRRRDFPIDNKKYCYTLNTTERRRYIVRTTFLYGSSENENTYPKFQLYLDATRWATVSVLDASTVYIKEMIIRAPSSSIDVCVCCATTGSPFLSTLELRPLNLSMYATDFEDNFFLKVAARVNFGASSTDAVRFPDDPYDRIWDSDLAKRQNFLVGVAPGTVRINTTKEINTNTREYPPVKVMQTAVVG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025785`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025785

Location Chr05:116878455-116882493 (+)

Description Similar to At1g67720: Probable LRR receptor-like serine/threonine-protein kinase At1g67720

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67720`	Probable LRR receptor-like serine/threonine-protein kinase At1g67720.	No verified direct reference in this release
`At3g21340`	Probable receptor with a dual specificity kinase activity acting on both serine/threonine- and tyrosine-containing substrates.	No verified direct reference in this release
`At2g14440`	Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g14440.	No verified direct reference in this release
`At2g14510`	Leucine-rich repeat receptor-like serine/threonine-protein kinase At2g14510.	No verified direct reference in this release
`At2g19230`	Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g19230.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025785 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004714 transmembrane receptor protein tyrosine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G67720

ath:AT2G14510

ath:AT2G19230

ath:AT3G21340

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.859

Rank 1 · LXL04_025785 · OH-1004

Endoplasmic reticulum0.080

Rank 2 · LXL04_025785 · OH-1004

Cytoplasm0.078

Rank 3 · LXL04_025785 · OH-1004

Nucleus0.047

Rank 4 · LXL04_025785 · OH-1004

Lysosome / Vacuole0.031

Rank 5 · LXL04_025785 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12819.14Malectin_like29-362 aa

PF13855.13LRR_8438-496 aa

PF12799.14LRR_4461-500 aa

PF07714.24PK_Tyr_Ser-Thr616-904 aa

PF00069.32Pkinase617-851 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025785	`PF12819.14`	Malectin_like	29	362	3.1e-83	280.5
LXL04_025785	`PF13855.13`	LRR_8	438	496	8.4e-07	29.4
LXL04_025785	`PF12799.14`	LRR_4	461	500	1.9e-09	38.2
LXL04_025785	`PF07714.24`	PK_Tyr_Ser-Thr	616	904	1.9e-51	175.6
LXL04_025785	`PF00069.32`	Pkinase	617	851	2.4e-43	149.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C0LGI2`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase At1g67720	66.805%	Swiss-Prot	strong database homology
`Q9LIG2`	Arabidopsis thaliana	Receptor-like protein kinase At3g21340	32.941%	Swiss-Prot	moderate database homology
`Q9ZQQ7`	Arabidopsis thaliana	Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g14440	33.018%	Swiss-Prot	moderate database homology
`Q9ZQR3`	Arabidopsis thaliana	Leucine-rich repeat receptor-like serine/threonine-protein kinase At2g14510	32.597%	Swiss-Prot	moderate database homology
`O64556`	Arabidopsis thaliana	Putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g19230	32.455%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card